Incidental Mutation 'R3964:Tbccd1'
ID312279
Institutional Source Beutler Lab
Gene Symbol Tbccd1
Ensembl Gene ENSMUSG00000004462
Gene NameTBCC domain containing 1
Synonyms5730478M09Rik
MMRRC Submission 040933-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3964 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22813214-22857669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22841773 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 98 (S98P)
Ref Sequence ENSEMBL: ENSMUSP00000156050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004576] [ENSMUST00000231513] [ENSMUST00000232075] [ENSMUST00000232251] [ENSMUST00000232345]
Predicted Effect probably benign
Transcript: ENSMUST00000004576
AA Change: S98P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000004576
Gene: ENSMUSG00000004462
AA Change: S98P

DomainStartEndE-ValueType
low complexity region 118 129 N/A INTRINSIC
low complexity region 144 160 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
CARP 337 374 5.55e-5 SMART
CARP 375 409 8.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231267
Predicted Effect probably benign
Transcript: ENSMUST00000231513
AA Change: S98P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232009
Predicted Effect probably benign
Transcript: ENSMUST00000232075
AA Change: S98P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000232251
AA Change: S98P

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably damaging
Transcript: ENSMUST00000232345
AA Change: S98P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232681
Meta Mutation Damage Score 0.2313 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Adam21 C A 12: 81,560,809 A60S possibly damaging Het
Arpp21 C G 9: 112,065,776 V805L probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cdh18 A T 15: 23,474,101 T686S probably benign Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cttnbp2nl T C 3: 105,006,005 K188E probably damaging Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Dhx57 T A 17: 80,265,112 K711* probably null Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Fam35a T A 14: 34,259,687 Q498L probably damaging Het
Gadl1 T C 9: 115,965,608 S284P probably damaging Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsdmc2 A G 15: 63,849,834 probably benign Het
Hmcn1 T C 1: 150,573,569 T110A probably benign Het
Il23r G A 6: 67,466,297 T274I probably benign Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Lrp1b A G 2: 41,312,470 probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Mrs2 A G 13: 25,001,763 I142T possibly damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Muc5b A T 7: 141,866,968 I4191F possibly damaging Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Nmi T C 2: 51,956,069 E67G possibly damaging Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Olfr350 A G 2: 36,850,717 T224A probably benign Het
Olfr904 T C 9: 38,464,683 I214T probably benign Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pcdhga12 A T 18: 37,767,201 Q362L probably benign Het
Peak1 C T 9: 56,259,979 E222K probably damaging Het
Pik3r1 T C 13: 101,688,685 E458G possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Plxdc2 T A 2: 16,660,840 F284I probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppfia4 A T 1: 134,323,016 D478E probably benign Het
Ptprd A G 4: 76,059,836 probably benign Het
Ptprj A G 2: 90,468,441 I315T probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Rnf13 G A 3: 57,769,112 G63S probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc50a1 T C 3: 89,268,786 I151V probably benign Het
Snx27 T A 3: 94,531,306 R207S probably damaging Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Tbc1d9b A G 11: 50,168,696 E975G possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Usp19 T A 9: 108,498,029 V818E probably damaging Het
Wdr38 A G 2: 38,999,350 Y51C probably damaging Het
Zfp456 T C 13: 67,366,781 T269A probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Tbccd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Tbccd1 APN 16 22822544 missense possibly damaging 0.81
PIT4243001:Tbccd1 UTSW 16 22822337 missense probably damaging 1.00
PIT4402001:Tbccd1 UTSW 16 22822123 missense probably damaging 1.00
R0055:Tbccd1 UTSW 16 22841905 missense probably damaging 1.00
R0092:Tbccd1 UTSW 16 22826094 missense possibly damaging 0.84
R0894:Tbccd1 UTSW 16 22822245 missense probably benign 0.27
R1183:Tbccd1 UTSW 16 22841769 missense probably benign 0.01
R1795:Tbccd1 UTSW 16 22822245 missense probably benign 0.27
R1813:Tbccd1 UTSW 16 22822521 missense probably benign
R2049:Tbccd1 UTSW 16 22818541 splice site probably null
R2131:Tbccd1 UTSW 16 22841989 missense probably benign 0.00
R4201:Tbccd1 UTSW 16 22825948 missense probably damaging 0.96
R4602:Tbccd1 UTSW 16 22818535 splice site probably null
R4921:Tbccd1 UTSW 16 22841899 missense probably benign 0.02
R6493:Tbccd1 UTSW 16 22822466 missense probably damaging 1.00
R6554:Tbccd1 UTSW 16 22822124 missense probably damaging 0.99
R6663:Tbccd1 UTSW 16 22834028 frame shift probably null
R7220:Tbccd1 UTSW 16 22833997 missense probably benign 0.21
R7431:Tbccd1 UTSW 16 22825813 missense probably benign 0.03
R8090:Tbccd1 UTSW 16 22842055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCAGGAGTGGGTAGCATTAAG -3'
(R):5'- TAGCCACCTATGTGCGAACTC -3'

Sequencing Primer
(F):5'- TGGGTAGCATTAAGGACTAATTAAGC -3'
(R):5'- TATGTGCGAACTCGGGCCAC -3'
Posted On2015-04-29