Incidental Mutation 'R3964:Sos1'
ID312281
Institutional Source Beutler Lab
Gene Symbol Sos1
Ensembl Gene ENSMUSG00000024241
Gene NameSOS Ras/Rac guanine nucleotide exchange factor 1
Synonyms4430401P03Rik
MMRRC Submission 040933-MU
Accession Numbers

Genbank: NM_009231.2; Ensembl: ENSMUST00000068714

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3964 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80393752-80480453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80455179 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 73 (R73H)
Ref Sequence ENSEMBL: ENSMUSP00000067786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068714]
PDB Structure
CRK SH3 DOMAIN COMPLEXED WITH PEPTOID INHIBITOR [X-RAY DIFFRACTION]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
PLECKSTRIN HOMOLOGY DOMAIN OF SON OF SEVENLESS 1 (SOS1) WITH GLYCINE-SERINE ADDED TO THE N-TERMINUS, NMR, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, MINIMIZED AVERAGE STRUCTURE [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF THE GRB2 N-TERMINAL SH3 DOMAIN COMPLEXED WITH A TEN-RESIDUE PEPTIDE DERIVED FROM SOS DIRECT REFINEMENT AGAINST NOES, J-COUPLINGS, AND 1H AND 13C CHEMICAL SHIFTS, 15 STRUCTURES [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000068714
AA Change: R73H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067786
Gene: ENSMUSG00000024241
AA Change: R73H

DomainStartEndE-ValueType
Pfam:Histone 40 169 6.8e-16 PFAM
RhoGEF 204 389 8.5e-35 SMART
PH 444 548 2.44e-17 SMART
RasGEFN 596 741 2.18e-56 SMART
RasGEF 776 1020 4.44e-102 SMART
low complexity region 1079 1093 N/A INTRINSIC
low complexity region 1116 1127 N/A INTRINSIC
low complexity region 1132 1154 N/A INTRINSIC
Blast:RasGEF 1155 1306 1e-51 BLAST
Meta Mutation Damage Score 0.1044 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a guanine nucleotide exchange factor for RAS proteins, membrane proteins that bind guanine nucleotides and participate in signal transduction pathways. GTP binding activates and GTP hydrolysis inactivates RAS proteins. The product of this gene may regulate RAS proteins by facilitating the exchange of GTP for GDP. Mutations in this gene are associated with gingival fibromatosis 1 and Noonan syndrome type 4. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutant embryos exhibit placental and cardiovascular defects resulting in death around mid-gestation. When heterozygous, these mutations enhance the eye defects of homozygous mutants of the epidermal growth factor receptor gene. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(21)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Adam21 C A 12: 81,560,809 A60S possibly damaging Het
Arpp21 C G 9: 112,065,776 V805L probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cdh18 A T 15: 23,474,101 T686S probably benign Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cttnbp2nl T C 3: 105,006,005 K188E probably damaging Het
Cux1 A G 5: 136,282,942 V1180A probably damaging Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Dhx57 T A 17: 80,265,112 K711* probably null Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Fam35a T A 14: 34,259,687 Q498L probably damaging Het
Gadl1 T C 9: 115,965,608 S284P probably damaging Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Gsdmc2 A G 15: 63,849,834 probably benign Het
Hmcn1 T C 1: 150,573,569 T110A probably benign Het
Il23r G A 6: 67,466,297 T274I probably benign Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Lrp1b A G 2: 41,312,470 probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Mrs2 A G 13: 25,001,763 I142T possibly damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Muc5b A T 7: 141,866,968 I4191F possibly damaging Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Nmi T C 2: 51,956,069 E67G possibly damaging Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Olfr350 A G 2: 36,850,717 T224A probably benign Het
Olfr904 T C 9: 38,464,683 I214T probably benign Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pcdhga12 A T 18: 37,767,201 Q362L probably benign Het
Peak1 C T 9: 56,259,979 E222K probably damaging Het
Pik3r1 T C 13: 101,688,685 E458G possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Plxdc2 T A 2: 16,660,840 F284I probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppfia4 A T 1: 134,323,016 D478E probably benign Het
Ptprd A G 4: 76,059,836 probably benign Het
Ptprj A G 2: 90,468,441 I315T probably benign Het
Rims1 T C 1: 22,427,459 probably null Het
Rnf13 G A 3: 57,769,112 G63S probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Slc50a1 T C 3: 89,268,786 I151V probably benign Het
Snx27 T A 3: 94,531,306 R207S probably damaging Het
Tbc1d9b A G 11: 50,168,696 E975G possibly damaging Het
Tbccd1 A G 16: 22,841,773 S98P probably damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Usp19 T A 9: 108,498,029 V818E probably damaging Het
Wdr38 A G 2: 38,999,350 Y51C probably damaging Het
Zfp456 T C 13: 67,366,781 T269A probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Sos1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00805:Sos1 APN 17 80398524 missense possibly damaging 0.94
IGL00915:Sos1 APN 17 80433938 missense probably benign 0.00
IGL00929:Sos1 APN 17 80408596 missense probably damaging 1.00
IGL01073:Sos1 APN 17 80422747 missense probably damaging 1.00
IGL01116:Sos1 APN 17 80445500 missense probably damaging 1.00
IGL01533:Sos1 APN 17 80415082 missense probably damaging 0.97
IGL01546:Sos1 APN 17 80408611 missense probably damaging 1.00
IGL01583:Sos1 APN 17 80433900 missense probably benign 0.11
IGL01628:Sos1 APN 17 80422677 splice site probably benign
IGL01837:Sos1 APN 17 80422728 missense probably damaging 1.00
IGL02170:Sos1 APN 17 80398290 missense probably damaging 0.99
IGL02426:Sos1 APN 17 80434943 missense possibly damaging 0.82
IGL02992:Sos1 APN 17 80419016 missense probably benign 0.01
IGL03037:Sos1 APN 17 80420329 missense probably damaging 0.98
1mM(1):Sos1 UTSW 17 80455057 missense possibly damaging 0.46
PIT4354001:Sos1 UTSW 17 80449356 missense possibly damaging 0.52
R0056:Sos1 UTSW 17 80413621 missense probably damaging 1.00
R0348:Sos1 UTSW 17 80408311 missense probably benign
R0373:Sos1 UTSW 17 80453763 missense probably damaging 1.00
R0477:Sos1 UTSW 17 80434934 missense possibly damaging 0.92
R0621:Sos1 UTSW 17 80451979 critical splice donor site probably null
R0839:Sos1 UTSW 17 80433730 missense probably damaging 1.00
R1174:Sos1 UTSW 17 80445608 nonsense probably null
R1490:Sos1 UTSW 17 80413675 missense probably benign 0.11
R1566:Sos1 UTSW 17 80453916 missense probably damaging 0.99
R1635:Sos1 UTSW 17 80422679 splice site probably null
R3412:Sos1 UTSW 17 80406717 missense probably benign
R3770:Sos1 UTSW 17 80398308 missense probably damaging 0.97
R3951:Sos1 UTSW 17 80424181 missense probably damaging 1.00
R3966:Sos1 UTSW 17 80455179 missense probably damaging 1.00
R4086:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4087:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4089:Sos1 UTSW 17 80449352 missense probably benign 0.06
R4194:Sos1 UTSW 17 80398584 missense probably benign 0.02
R4468:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4469:Sos1 UTSW 17 80453811 missense probably damaging 1.00
R4597:Sos1 UTSW 17 80433826 missense probably benign 0.05
R4773:Sos1 UTSW 17 80398231 missense probably damaging 0.99
R4923:Sos1 UTSW 17 80434952 missense probably benign 0.10
R5120:Sos1 UTSW 17 80408248 missense probably damaging 0.98
R5478:Sos1 UTSW 17 80433847 missense probably damaging 1.00
R5566:Sos1 UTSW 17 80453890 missense possibly damaging 0.91
R5984:Sos1 UTSW 17 80452132 missense possibly damaging 0.68
R6053:Sos1 UTSW 17 80415034 missense possibly damaging 0.94
R6153:Sos1 UTSW 17 80449335 missense probably benign 0.01
R6567:Sos1 UTSW 17 80433503 missense probably damaging 1.00
R7392:Sos1 UTSW 17 80424200 missense probably damaging 1.00
R7623:Sos1 UTSW 17 80479894 missense probably benign 0.28
R7763:Sos1 UTSW 17 80413713 missense probably benign
X0020:Sos1 UTSW 17 80449277 missense probably damaging 1.00
Z1177:Sos1 UTSW 17 80453918 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAAACCACGTTGTCCAACC -3'
(R):5'- AAACTGTCCTTAGTCCCTTAGTGAC -3'

Sequencing Primer
(F):5'- TTACCTCAACATGAATCCCTGG -3'
(R):5'- GTCCTTAGTCCCTTAGTGACCTAAC -3'
Posted On2015-04-29