Incidental Mutation 'R0385:Usb1'
ID31229
Institutional Source Beutler Lab
Gene Symbol Usb1
Ensembl Gene ENSMUSG00000031792
Gene NameU6 snRNA biogenesis 1
SynonymsAA960436
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0385 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location95332284-95347507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 95345318 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 215 (W215C)
Ref Sequence ENSEMBL: ENSMUSP00000034245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034245] [ENSMUST00000126180]
Predicted Effect probably damaging
Transcript: ENSMUST00000034245
AA Change: W215C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034245
Gene: ENSMUSG00000031792
AA Change: W215C

DomainStartEndE-ValueType
Pfam:HVSL 45 265 6.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126180
SMART Domains Protein: ENSMUSP00000122529
Gene: ENSMUSG00000031792

DomainStartEndE-ValueType
Pfam:HVSL 1 113 6.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151223
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Usb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03164:Usb1 APN 8 95333484 missense probably damaging 1.00
R0276:Usb1 UTSW 8 95333457 missense probably damaging 1.00
R0730:Usb1 UTSW 8 95344041 missense probably damaging 1.00
R0801:Usb1 UTSW 8 95333540 splice site probably null
R1497:Usb1 UTSW 8 95338697 missense probably benign 0.00
R2230:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2231:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2232:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2402:Usb1 UTSW 8 95343131 missense probably benign 0.06
R2507:Usb1 UTSW 8 95343124 missense probably damaging 1.00
R3821:Usb1 UTSW 8 95333433 missense probably benign 0.35
R5085:Usb1 UTSW 8 95344051 missense probably damaging 0.98
R5834:Usb1 UTSW 8 95333533 utr 3 prime probably benign
R7398:Usb1 UTSW 8 95345303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCCTCATGAACCGTCAAATAC -3'
(R):5'- TCTCCTCACAGGACAGGGTTGTAAG -3'

Sequencing Primer
(F):5'- AGAGGCACCAGCTATTATGTCTG -3'
(R):5'- gcacacggagccatagag -3'
Posted On2013-04-24