Incidental Mutation 'R3965:Tpcn1'
ID312299
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 040934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3965 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120556575 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 143 (T143K)
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably damaging
Transcript: ENSMUST00000046426
AA Change: T143K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741
AA Change: T143K

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201971
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,991 C363S probably benign Het
5330417C22Rik T C 3: 108,458,449 D998G probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Cfap74 T A 4: 155,446,717 M809K probably damaging Het
Clic6 T C 16: 92,498,844 S131P probably benign Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlec1 A G 9: 119,128,581 I878V probably benign Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Ewsr1 T C 11: 5,083,476 Y232C unknown Het
Exoc2 G A 13: 30,877,582 S492L probably benign Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Grin2c G A 11: 115,260,994 R47W probably damaging Het
Igfn1 T C 1: 135,967,819 T1670A probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mia2 T A 12: 59,176,372 S489T probably damaging Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Nckap1l T A 15: 103,464,589 C276* probably null Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Oas1c A G 5: 120,808,718 F16L probably damaging Het
Olfr1487 T C 19: 13,619,201 L13P probably damaging Het
Olfr374 G A 8: 72,110,264 G233R probably damaging Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pik3c2g A G 6: 139,855,292 M388V possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppp6r2 A G 15: 89,259,114 K155E probably benign Het
Rxra T A 2: 27,752,306 probably benign Het
Susd5 A G 9: 114,096,192 E381G possibly damaging Het
Svs2 T C 2: 164,237,742 T82A possibly damaging Het
Syt14 A T 1: 192,901,867 H413Q probably benign Het
Tg T A 15: 66,684,190 D910E probably benign Het
Trbv5 G T 6: 41,062,408 probably benign Het
Trhr T A 15: 44,197,699 I205N possibly damaging Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Trpc6 G A 9: 8,626,621 C324Y probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Zfhx4 G T 3: 5,403,847 V3022F probably damaging Het
Zswim8 G A 14: 20,713,073 V347I probably benign Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5910:Tpcn1 UTSW 5 120547397 intron probably benign
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R8478:Tpcn1 UTSW 5 120560321 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTCACTGGGCTACACTCC -3'
(R):5'- CTCTGTCTATAAAGCCTTGTCTGG -3'

Sequencing Primer
(F):5'- TTTAAATGGAACCGTAGACACAGATG -3'
(R):5'- CCTTGTCTGGCATCTTGAGG -3'
Posted On2015-04-29