Incidental Mutation 'R3965:Susd5'
ID312312
Institutional Source Beutler Lab
Gene Symbol Susd5
Ensembl Gene ENSMUSG00000086596
Gene Namesushi domain containing 5
SynonymsLOC382111
MMRRC Submission 040934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3965 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114057140-114098728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114096192 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000128826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000135338]
Predicted Effect possibly damaging
Transcript: ENSMUST00000135338
AA Change: E381G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128826
Gene: ENSMUSG00000086596
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LINK 33 130 7.42e-26 SMART
CCP 136 193 9.65e-1 SMART
low complexity region 416 428 N/A INTRINSIC
low complexity region 485 496 N/A INTRINSIC
transmembrane domain 566 588 N/A INTRINSIC
Meta Mutation Damage Score 0.0756 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,991 C363S probably benign Het
5330417C22Rik T C 3: 108,458,449 D998G probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Cfap74 T A 4: 155,446,717 M809K probably damaging Het
Clic6 T C 16: 92,498,844 S131P probably benign Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlec1 A G 9: 119,128,581 I878V probably benign Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Ewsr1 T C 11: 5,083,476 Y232C unknown Het
Exoc2 G A 13: 30,877,582 S492L probably benign Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Grin2c G A 11: 115,260,994 R47W probably damaging Het
Igfn1 T C 1: 135,967,819 T1670A probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mia2 T A 12: 59,176,372 S489T probably damaging Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Nckap1l T A 15: 103,464,589 C276* probably null Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Oas1c A G 5: 120,808,718 F16L probably damaging Het
Olfr1487 T C 19: 13,619,201 L13P probably damaging Het
Olfr374 G A 8: 72,110,264 G233R probably damaging Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pik3c2g A G 6: 139,855,292 M388V possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppp6r2 A G 15: 89,259,114 K155E probably benign Het
Rxra T A 2: 27,752,306 probably benign Het
Svs2 T C 2: 164,237,742 T82A possibly damaging Het
Syt14 A T 1: 192,901,867 H413Q probably benign Het
Tg T A 15: 66,684,190 D910E probably benign Het
Tpcn1 G T 5: 120,556,575 T143K probably damaging Het
Trbv5 G T 6: 41,062,408 probably benign Het
Trhr T A 15: 44,197,699 I205N possibly damaging Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Trpc6 G A 9: 8,626,621 C324Y probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Zfhx4 G T 3: 5,403,847 V3022F probably damaging Het
Zswim8 G A 14: 20,713,073 V347I probably benign Het
Other mutations in Susd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Susd5 APN 9 114068879 splice site probably benign
IGL01720:Susd5 APN 9 114063984 missense possibly damaging 0.85
IGL02739:Susd5 APN 9 114096033 missense possibly damaging 0.72
H8441:Susd5 UTSW 9 114096185 nonsense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0238:Susd5 UTSW 9 114096909 makesense probably null
R0650:Susd5 UTSW 9 114082535 missense possibly damaging 0.53
R0666:Susd5 UTSW 9 114095784 missense possibly damaging 0.53
R1478:Susd5 UTSW 9 114096684 missense probably benign
R1672:Susd5 UTSW 9 114068822 missense probably damaging 0.99
R3416:Susd5 UTSW 9 114095658 missense possibly damaging 0.85
R4182:Susd5 UTSW 9 114095985 missense probably benign 0.12
R4514:Susd5 UTSW 9 114095924 missense probably benign 0.18
R5373:Susd5 UTSW 9 114082585 missense probably damaging 1.00
R5947:Susd5 UTSW 9 114057591 missense possibly damaging 0.96
R6189:Susd5 UTSW 9 114095658 missense probably damaging 0.98
R6349:Susd5 UTSW 9 114095802 missense probably benign 0.33
R7535:Susd5 UTSW 9 114064040 missense possibly damaging 0.92
Z1176:Susd5 UTSW 9 114096140 missense probably damaging 0.98
Z1177:Susd5 UTSW 9 114064067 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCTGCCAGAGACAATCAC -3'
(R):5'- TCAGTCTCAGACACATTGATGGG -3'

Sequencing Primer
(F):5'- CTGCCAGAGACAATCACAGTGAAG -3'
(R):5'- ACACATTGATGGGTCCTGGAACC -3'
Posted On2015-04-29