Incidental Mutation 'R3965:Dlec1'
ID312313
Institutional Source Beutler Lab
Gene Symbol Dlec1
Ensembl Gene ENSMUSG00000038060
Gene Namedeleted in lung and esophageal cancer 1
SynonymsD630005C06Rik
MMRRC Submission 040934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3965 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119102478-119148246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119128581 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 878 (I878V)
Ref Sequence ENSEMBL: ENSMUSP00000128874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055775] [ENSMUST00000140326] [ENSMUST00000165231]
Predicted Effect probably benign
Transcript: ENSMUST00000055775
SMART Domains Protein: ENSMUSP00000052645
Gene: ENSMUSG00000038060

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138736
Predicted Effect probably benign
Transcript: ENSMUST00000140326
AA Change: I878V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122380
Gene: ENSMUSG00000038060
AA Change: I878V

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148611
Predicted Effect probably benign
Transcript: ENSMUST00000165231
AA Change: I878V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128874
Gene: ENSMUSG00000038060
AA Change: I878V

DomainStartEndE-ValueType
coiled coil region 127 154 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cytogenetic location of this gene is 3p21.3, and it is located in a region that is commonly deleted in a variety of malignancies. Down-regulation of this gene has been observed in several human cancers including lung, esophageal, renal tumors, and head and neck squamous cell carcinoma. In some cases, reduced expression of this gene in tumor cells is a result of aberrant promoter methylation. Several alternatively spliced transcripts have been observed that contain disrupted coding regions and likely encode nonfunctional proteins.[provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,991 C363S probably benign Het
5330417C22Rik T C 3: 108,458,449 D998G probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Cfap74 T A 4: 155,446,717 M809K probably damaging Het
Clic6 T C 16: 92,498,844 S131P probably benign Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Ewsr1 T C 11: 5,083,476 Y232C unknown Het
Exoc2 G A 13: 30,877,582 S492L probably benign Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Grin2c G A 11: 115,260,994 R47W probably damaging Het
Igfn1 T C 1: 135,967,819 T1670A probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mia2 T A 12: 59,176,372 S489T probably damaging Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Nckap1l T A 15: 103,464,589 C276* probably null Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Oas1c A G 5: 120,808,718 F16L probably damaging Het
Olfr1487 T C 19: 13,619,201 L13P probably damaging Het
Olfr374 G A 8: 72,110,264 G233R probably damaging Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pik3c2g A G 6: 139,855,292 M388V possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppp6r2 A G 15: 89,259,114 K155E probably benign Het
Rxra T A 2: 27,752,306 probably benign Het
Susd5 A G 9: 114,096,192 E381G possibly damaging Het
Svs2 T C 2: 164,237,742 T82A possibly damaging Het
Syt14 A T 1: 192,901,867 H413Q probably benign Het
Tg T A 15: 66,684,190 D910E probably benign Het
Tpcn1 G T 5: 120,556,575 T143K probably damaging Het
Trbv5 G T 6: 41,062,408 probably benign Het
Trhr T A 15: 44,197,699 I205N possibly damaging Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Trpc6 G A 9: 8,626,621 C324Y probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Zfhx4 G T 3: 5,403,847 V3022F probably damaging Het
Zswim8 G A 14: 20,713,073 V347I probably benign Het
Other mutations in Dlec1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Dlec1 APN 9 119102785 missense probably benign 0.11
IGL01137:Dlec1 APN 9 119137311 missense probably damaging 1.00
IGL01338:Dlec1 APN 9 119120911 missense probably damaging 1.00
IGL01652:Dlec1 APN 9 119143907 missense probably benign 0.01
IGL01923:Dlec1 APN 9 119128114 splice site probably null
IGL02186:Dlec1 APN 9 119143627 missense probably benign 0.00
IGL02597:Dlec1 APN 9 119134536 missense probably damaging 0.99
IGL02667:Dlec1 APN 9 119127466 missense probably benign 0.23
IGL02718:Dlec1 APN 9 119137286 missense probably benign 0.01
IGL02731:Dlec1 APN 9 119147120 missense probably benign 0.00
IGL02831:Dlec1 APN 9 119143915 missense probably damaging 1.00
IGL03390:Dlec1 APN 9 119123220 missense probably benign 0.00
I2288:Dlec1 UTSW 9 119143601 missense probably damaging 1.00
R0109:Dlec1 UTSW 9 119105824 missense probably damaging 1.00
R0144:Dlec1 UTSW 9 119142866 missense probably benign
R0554:Dlec1 UTSW 9 119115002 missense probably benign 0.44
R0611:Dlec1 UTSW 9 119112099 missense probably benign 0.01
R1344:Dlec1 UTSW 9 119130017 missense probably benign 0.09
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1467:Dlec1 UTSW 9 119128003 splice site probably benign
R1467:Dlec1 UTSW 9 119142578 missense probably damaging 1.00
R1539:Dlec1 UTSW 9 119127450 missense probably benign 0.00
R1768:Dlec1 UTSW 9 119146007 splice site probably null
R1809:Dlec1 UTSW 9 119136699 missense probably benign 0.00
R1830:Dlec1 UTSW 9 119138790 missense probably benign 0.00
R1901:Dlec1 UTSW 9 119102644 missense probably damaging 0.99
R2060:Dlec1 UTSW 9 119112086 missense probably damaging 1.00
R2092:Dlec1 UTSW 9 119121844 missense possibly damaging 0.87
R2237:Dlec1 UTSW 9 119138191 critical splice donor site probably null
R2983:Dlec1 UTSW 9 119146173 missense probably benign 0.00
R3117:Dlec1 UTSW 9 119143903 unclassified probably null
R3816:Dlec1 UTSW 9 119124843 missense probably damaging 1.00
R3826:Dlec1 UTSW 9 119143061 splice site probably benign
R4023:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4024:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4026:Dlec1 UTSW 9 119137340 missense probably damaging 0.98
R4272:Dlec1 UTSW 9 119143163 missense probably damaging 0.98
R4545:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4546:Dlec1 UTSW 9 119128078 missense probably damaging 0.99
R4601:Dlec1 UTSW 9 119147134 critical splice donor site probably null
R4695:Dlec1 UTSW 9 119143153 missense probably benign 0.00
R4996:Dlec1 UTSW 9 119146050 missense probably damaging 1.00
R5321:Dlec1 UTSW 9 119112601 missense probably benign 0.02
R5521:Dlec1 UTSW 9 119143401 missense possibly damaging 0.92
R5650:Dlec1 UTSW 9 119143594 nonsense probably null
R5825:Dlec1 UTSW 9 119142968 missense probably damaging 1.00
R5941:Dlec1 UTSW 9 119126312 missense probably damaging 0.98
R6056:Dlec1 UTSW 9 119121923 missense probably damaging 0.98
R6111:Dlec1 UTSW 9 119102624 missense possibly damaging 0.59
R6156:Dlec1 UTSW 9 119110213 critical splice donor site probably null
R6160:Dlec1 UTSW 9 119143319 missense probably benign 0.02
R6195:Dlec1 UTSW 9 119137253 missense probably benign 0.00
R6364:Dlec1 UTSW 9 119121871 missense possibly damaging 0.84
R6480:Dlec1 UTSW 9 119147690 missense probably benign 0.34
R6808:Dlec1 UTSW 9 119126174 missense probably benign 0.01
R6813:Dlec1 UTSW 9 119112102 missense probably benign 0.02
R7019:Dlec1 UTSW 9 119112422 missense probably benign 0.01
R7048:Dlec1 UTSW 9 119143404 splice site probably null
R7187:Dlec1 UTSW 9 119112146 missense probably benign 0.14
R7230:Dlec1 UTSW 9 119124538 intron probably null
Predicted Primers PCR Primer
(F):5'- GCCTCATTTAAGGTGCCATGG -3'
(R):5'- GCATCCAGTGTTTGAAAAGGGG -3'

Sequencing Primer
(F):5'- CATTTAAGGTGCCATGGGAGGG -3'
(R):5'- GGACGAATTCCACACTAGAGACTG -3'
Posted On2015-04-29