Incidental Mutation 'R3965:Gm12169'
ID312316
Institutional Source Beutler Lab
Gene Symbol Gm12169
Ensembl Gene ENSMUSG00000078924
Gene Namepredicted gene 12169
Synonyms
MMRRC Submission 040934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R3965 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46524212-46538156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46535513 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 149 (V149D)
Ref Sequence ENSEMBL: ENSMUSP00000104851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109228
AA Change: V149D

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104851
Gene: ENSMUSG00000078924
AA Change: V149D

DomainStartEndE-ValueType
IG 22 128 3.76e-8 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119281
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,991 C363S probably benign Het
5330417C22Rik T C 3: 108,458,449 D998G probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
Cep70 T A 9: 99,298,534 F581I probably damaging Het
Cfap74 T A 4: 155,446,717 M809K probably damaging Het
Clic6 T C 16: 92,498,844 S131P probably benign Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlec1 A G 9: 119,128,581 I878V probably benign Het
Esyt3 T A 9: 99,320,322 D512V probably damaging Het
Ewsr1 T C 11: 5,083,476 Y232C unknown Het
Exoc2 G A 13: 30,877,582 S492L probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Grin2c G A 11: 115,260,994 R47W probably damaging Het
Igfn1 T C 1: 135,967,819 T1670A probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Mia2 T A 12: 59,176,372 S489T probably damaging Het
Mov10l1 A G 15: 89,012,163 I737V probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Nckap1l T A 15: 103,464,589 C276* probably null Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Oas1c A G 5: 120,808,718 F16L probably damaging Het
Olfr1487 T C 19: 13,619,201 L13P probably damaging Het
Olfr374 G A 8: 72,110,264 G233R probably damaging Het
Olfr916 G A 9: 38,657,727 L222F probably benign Het
Olfr979 A T 9: 40,000,471 V252E possibly damaging Het
Pik3c2g A G 6: 139,855,292 M388V possibly damaging Het
Pls1 T C 9: 95,785,612 Q81R probably benign Het
Pole A G 5: 110,312,782 K1143E probably damaging Het
Ppp6r2 A G 15: 89,259,114 K155E probably benign Het
Rxra T A 2: 27,752,306 probably benign Het
Susd5 A G 9: 114,096,192 E381G possibly damaging Het
Svs2 T C 2: 164,237,742 T82A possibly damaging Het
Syt14 A T 1: 192,901,867 H413Q probably benign Het
Tg T A 15: 66,684,190 D910E probably benign Het
Tpcn1 G T 5: 120,556,575 T143K probably damaging Het
Trbv5 G T 6: 41,062,408 probably benign Het
Trhr T A 15: 44,197,699 I205N possibly damaging Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Trpc6 G A 9: 8,626,621 C324Y probably damaging Het
Upf1 C T 8: 70,338,460 R544H probably damaging Het
Zfhx4 G T 3: 5,403,847 V3022F probably damaging Het
Zswim8 G A 14: 20,713,073 V347I probably benign Het
Other mutations in Gm12169
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB009:Gm12169 UTSW 11 46535539 missense probably benign 0.13
BB019:Gm12169 UTSW 11 46535539 missense probably benign 0.13
R0314:Gm12169 UTSW 11 46528537 missense probably damaging 1.00
R0959:Gm12169 UTSW 11 46536420 nonsense probably null
R1602:Gm12169 UTSW 11 46535588 missense probably benign 0.00
R1719:Gm12169 UTSW 11 46526294 missense probably damaging 1.00
R1917:Gm12169 UTSW 11 46528531 missense possibly damaging 0.82
R1918:Gm12169 UTSW 11 46528531 missense possibly damaging 0.82
R1919:Gm12169 UTSW 11 46528531 missense possibly damaging 0.82
R2202:Gm12169 UTSW 11 46528567 missense probably benign 0.06
R2205:Gm12169 UTSW 11 46528567 missense probably benign 0.06
R3964:Gm12169 UTSW 11 46535513 missense possibly damaging 0.56
R3966:Gm12169 UTSW 11 46535513 missense possibly damaging 0.56
R5022:Gm12169 UTSW 11 46528532 missense probably damaging 0.97
R5023:Gm12169 UTSW 11 46528532 missense probably damaging 0.97
R7294:Gm12169 UTSW 11 46535612 missense probably benign 0.41
R7441:Gm12169 UTSW 11 46528555 nonsense probably null
R7932:Gm12169 UTSW 11 46535539 missense probably benign 0.13
R8027:Gm12169 UTSW 11 46537917 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTATCTAGAGTAGTGCAGC -3'
(R):5'- GAAGAGTAAAACATTTTGCCCTACC -3'

Sequencing Primer
(F):5'- GTCCTAGAACTGCTGTTTAGACCAG -3'
(R):5'- CCAAACAAACTTCCTTGGATTTTG -3'
Posted On2015-04-29