Incidental Mutation 'R3966:Agap1'
ID312332
Institutional Source Beutler Lab
Gene Symbol Agap1
Ensembl Gene ENSMUSG00000055013
Gene NameArfGAP with GTPase domain, ankyrin repeat and PH domain 1
SynonymsGgap1, Centg2
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location89454806-89897617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89834461 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 371 (I371T)
Ref Sequence ENSEMBL: ENSMUSP00000074478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]
Predicted Effect probably damaging
Transcript: ENSMUST00000027521
AA Change: I558T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: I558T

DomainStartEndE-ValueType
Pfam:Ras 73 231 1.1e-18 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 590 1.36e-15 SMART
ArfGap 609 729 4.58e-51 SMART
ANK 768 797 1.83e-3 SMART
ANK 801 832 1.33e2 SMART
low complexity region 840 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074945
AA Change: I371T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: I371T

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190096
AA Change: I505T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: I505T

DomainStartEndE-ValueType
Pfam:Miro 73 181 5e-24 PFAM
Pfam:Ras 73 231 3e-19 PFAM
low complexity region 269 289 N/A INTRINSIC
PH 347 537 7.93e-17 SMART
ArfGap 556 676 4.58e-51 SMART
ANK 715 744 1.83e-3 SMART
ANK 748 779 1.33e2 SMART
low complexity region 787 799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212924
AA Change: I89T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Agap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Agap1 APN 1 89663796 splice site probably benign
IGL00310:Agap1 APN 1 89887670 missense probably damaging 1.00
IGL01104:Agap1 APN 1 89726075 splice site probably benign
IGL02227:Agap1 APN 1 89663775 missense probably damaging 0.99
IGL02959:Agap1 APN 1 89843191 missense possibly damaging 0.94
IGL03303:Agap1 APN 1 89665152 missense probably damaging 1.00
K3955:Agap1 UTSW 1 89887604 missense probably damaging 1.00
R0030:Agap1 UTSW 1 89888744 nonsense probably null
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0234:Agap1 UTSW 1 89671212 missense probably damaging 1.00
R0400:Agap1 UTSW 1 89843250 splice site probably benign
R1104:Agap1 UTSW 1 89789240 missense probably damaging 0.99
R1160:Agap1 UTSW 1 89843154 missense probably damaging 0.98
R1439:Agap1 UTSW 1 89843186 missense probably damaging 1.00
R1454:Agap1 UTSW 1 89837806 splice site probably null
R1644:Agap1 UTSW 1 89663730 missense probably damaging 0.97
R1984:Agap1 UTSW 1 89766323 missense probably benign
R2141:Agap1 UTSW 1 89837755 missense probably damaging 0.99
R4195:Agap1 UTSW 1 89834539 missense probably damaging 0.99
R4669:Agap1 UTSW 1 89837806 splice site probably null
R4951:Agap1 UTSW 1 89609503 missense probably damaging 1.00
R5525:Agap1 UTSW 1 89743773 missense possibly damaging 0.86
R5843:Agap1 UTSW 1 89609550 missense probably damaging 0.97
R5930:Agap1 UTSW 1 89843096 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6030:Agap1 UTSW 1 89630434 missense probably damaging 1.00
R6879:Agap1 UTSW 1 89766455 missense probably benign 0.25
R7027:Agap1 UTSW 1 89888722 missense probably benign 0.00
R7207:Agap1 UTSW 1 89843099 missense possibly damaging 0.91
R7268:Agap1 UTSW 1 89766348 missense probably benign 0.02
R7289:Agap1 UTSW 1 89455431 start codon destroyed probably null 0.01
Predicted Primers PCR Primer
(F):5'- TGTGGATCAGATCTCAGCGC -3'
(R):5'- CAAGCCATTTGACGCCTCTG -3'

Sequencing Primer
(F):5'- GATCAGATCTCAGCGCTCCCATC -3'
(R):5'- GGCTCCACTTGGGCCTTC -3'
Posted On2015-04-29