Mutagenetix > Incidental Mutations

Incidental Mutation 'R3966:Agap1'

312332

Institutional Source

Beutler Lab

Gene Symbol

Agap1

Ensembl Gene

ENSMUSG00000055013

Gene Name

ArfGAP with GTPase domain, ankyrin repeat and PH domain 1

Synonyms

Ggap1, Centg2

MMRRC Submission

040935-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.149) question?

Stock #

R3966 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89454806-89897617 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 89834461 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 371 (I371T)

Ref Sequence

ENSEMBL: ENSMUSP00000074478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027521] [ENSMUST00000074945] [ENSMUST00000190096]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027521
AA Change: I558T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027521
Gene: ENSMUSG00000055013
AA Change: I558T

Domain	Start	End	E-Value	Type
Pfam:Ras	73	231	1.1e-18	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	590	1.36e-15	SMART
ArfGap	609	729	4.58e-51	SMART
ANK	768	797	1.83e-3	SMART
ANK	801	832	1.33e2	SMART
low complexity region	840	852	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000074945
AA Change: I371T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000074478
Gene: ENSMUSG00000055013
AA Change: I371T

Domain	Start	End	E-Value	Type
Pfam:Miro	73	181	5e-24	PFAM
Pfam:Ras	73	231	3e-19	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	537	7.93e-17	SMART
ArfGap	556	676	4.58e-51	SMART
ANK	715	744	1.83e-3	SMART
ANK	748	779	1.33e2	SMART
low complexity region	787	799	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190096
AA Change: I505T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000140599
Gene: ENSMUSG00000055013
AA Change: I505T

Domain	Start	End	E-Value	Type
Pfam:Miro	73	181	5e-24	PFAM
Pfam:Ras	73	231	3e-19	PFAM
low complexity region	269	289	N/A	INTRINSIC
PH	347	537	7.93e-17	SMART
ArfGap	556	676	4.58e-51	SMART
ANK	715	744	1.83e-3	SMART
ANK	748	779	1.33e2	SMART
low complexity region	787	799	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212924
AA Change: I89T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.8257

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an ADP-ribosylation factor GTPase-activating protein family involved in membrane trafficking and cytoskeleton dynamics. This gene functions as a direct regulator of the adaptor-related protein complex 3 on endosomes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530099J19Rik	A	G	13: 19,729,444		noncoding transcript	Het
Brwd1	G	A	16: 96,044,530	T731I	probably damaging	Het
C1galt1c1	A	T	X: 38,631,576	V181E	probably benign	Het
C3	A	G	17: 57,218,664	V864A	probably damaging	Het
Cadps	A	T	14: 12,522,161		probably null	Het
Cemip	T	A	7: 83,951,509	Y968F	probably benign	Het
Ces1g	C	A	8: 93,328,511	R186L	possibly damaging	Het
Chd2	A	G	7: 73,464,395		probably benign	Het
Clptm1l	T	C	13: 73,615,972	Y404H	probably damaging	Het
CN725425	T	A	15: 91,242,687		probably null	Het
Ctc1	T	A	11: 69,031,128	V800D	probably damaging	Het
Cyp1a1	T	A	9: 57,700,149	V20D	probably benign	Het
E330034G19Rik	G	T	14: 24,306,871	M158I	unknown	Het
Ehbp1l1	C	T	19: 5,710,573		probably null	Het
Gm12169	T	A	11: 46,535,513	V149D	possibly damaging	Het
Gm14137	T	A	2: 119,175,016	S19T	probably benign	Het
Gprc6a	CAAA	CA	10: 51,615,680		probably null	Het
Inhbb	C	A	1: 119,417,561	G333W	probably damaging	Het
Kcnb1	C	T	2: 167,104,492	C812Y	probably damaging	Het
Kdm4c	A	G	4: 74,298,583	D193G	probably damaging	Het
Mbd5	A	T	2: 49,272,070	I855L	possibly damaging	Het
Mcpt1	G	A	14: 56,019,046	V80M	probably benign	Het
Med31	C	T	11: 72,211,929	A118T	probably benign	Het
Megf10	A	G	18: 57,180,574	D30G	probably damaging	Het
Ms4a6b	T	C	19: 11,521,734	S71P	probably benign	Het
Muc2	G	A	7: 141,699,664	R120H	probably benign	Het
Mycbp2	A	G	14: 103,138,725		probably benign	Het
Myrf	T	C	19: 10,219,615	E267G	probably benign	Het
Ncor1	T	C	11: 62,344,757	T624A	probably damaging	Het
Nfat5	G	T	8: 107,367,289	A721S	possibly damaging	Het
Nfatc2	C	T	2: 168,504,549	S875N	probably benign	Het
Npm1	C	T	11: 33,160,350	G148D	probably benign	Het
Nrap	T	C	19: 56,342,144	S1126G	probably damaging	Het
Nucb2	A	G	7: 116,528,875	E273G	probably damaging	Het
Prkd1	C	T	12: 50,392,941	E368K	probably benign	Het
Ptgs2	T	A	1: 150,105,475	I503N	probably damaging	Het
Qrfpr	A	G	3: 36,181,000	S243P	possibly damaging	Het
Safb2	T	C	17: 56,575,356	S426G	probably null	Het
Sos1	C	T	17: 80,455,179	R73H	probably damaging	Het
Spink10	T	C	18: 62,657,904	I87T	probably damaging	Het
Tet2	A	G	3: 133,487,657	S339P	possibly damaging	Het
Tmx4	T	C	2: 134,600,061	I206V	possibly damaging	Het
Tom1	A	G	8: 75,059,239	K360E	probably benign	Het
Trp73	A	G	4: 154,062,036	V422A	probably benign	Het
Vmn2r33	T	C	7: 7,554,169	M511V	probably benign	Het
Zfp628	T	C	7: 4,921,745	S989P	probably benign	Het

Other mutations in Agap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Agap1	APN	1	89663796	splice site	probably benign
IGL00310:Agap1	APN	1	89887670	missense	probably damaging	1.00
IGL01104:Agap1	APN	1	89726075	splice site	probably benign
IGL02227:Agap1	APN	1	89663775	missense	probably damaging	0.99
IGL02959:Agap1	APN	1	89843191	missense	possibly damaging	0.94
IGL03303:Agap1	APN	1	89665152	missense	probably damaging	1.00
K3955:Agap1	UTSW	1	89887604	missense	probably damaging	1.00
R0030:Agap1	UTSW	1	89888744	nonsense	probably null
R0234:Agap1	UTSW	1	89671212	missense	probably damaging	1.00
R0234:Agap1	UTSW	1	89671212	missense	probably damaging	1.00
R0400:Agap1	UTSW	1	89843250	splice site	probably benign
R1104:Agap1	UTSW	1	89789240	missense	probably damaging	0.99
R1160:Agap1	UTSW	1	89843154	missense	probably damaging	0.98
R1439:Agap1	UTSW	1	89843186	missense	probably damaging	1.00
R1454:Agap1	UTSW	1	89837806	splice site	probably null
R1644:Agap1	UTSW	1	89663730	missense	probably damaging	0.97
R1984:Agap1	UTSW	1	89766323	missense	probably benign
R2141:Agap1	UTSW	1	89837755	missense	probably damaging	0.99
R4195:Agap1	UTSW	1	89834539	missense	probably damaging	0.99
R4669:Agap1	UTSW	1	89837806	splice site	probably null
R4951:Agap1	UTSW	1	89609503	missense	probably damaging	1.00
R5525:Agap1	UTSW	1	89743773	missense	possibly damaging	0.86
R5843:Agap1	UTSW	1	89609550	missense	probably damaging	0.97
R5930:Agap1	UTSW	1	89843096	missense	probably damaging	1.00
R6030:Agap1	UTSW	1	89630434	missense	probably damaging	1.00
R6030:Agap1	UTSW	1	89630434	missense	probably damaging	1.00
R6879:Agap1	UTSW	1	89766455	missense	probably benign	0.25
R7027:Agap1	UTSW	1	89888722	missense	probably benign	0.00
R7207:Agap1	UTSW	1	89843099	missense	possibly damaging	0.91
R7268:Agap1	UTSW	1	89766348	missense	probably benign	0.02
R7289:Agap1	UTSW	1	89455431	start codon destroyed	probably null	0.01
R7689:Agap1	UTSW	1	89834466	missense	probably damaging	1.00
R7690:Agap1	UTSW	1	89843071	missense	probably benign	0.43
R7801:Agap1	UTSW	1	89630485	missense	probably damaging	1.00
R7849:Agap1	UTSW	1	89630419	missense	probably damaging	0.99
R8364:Agap1	UTSW	1	89887674	missense	probably damaging	1.00
RF015:Agap1	UTSW	1	89634263	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTGGATCAGATCTCAGCGC -3'
(R):5'- CAAGCCATTTGACGCCTCTG -3'

Sequencing Primer
(F):5'- GATCAGATCTCAGCGCTCCCATC -3'
(R):5'- GGCTCCACTTGGGCCTTC -3'

Posted On

2015-04-29