Incidental Mutation 'R3966:Inhbb'
ID312333
Institutional Source Beutler Lab
Gene Symbol Inhbb
Ensembl Gene ENSMUSG00000037035
Gene Nameinhibin beta-B
Synonymsactivin
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.690) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location119415465-119422248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 119417561 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 333 (G333W)
Ref Sequence ENSEMBL: ENSMUSP00000044918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038765]
Predicted Effect probably damaging
Transcript: ENSMUST00000038765
AA Change: G333W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044918
Gene: ENSMUSG00000037035
AA Change: G333W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TGFb_propeptide 66 282 1.4e-13 PFAM
TGFB 307 411 5.55e-53 SMART
Meta Mutation Damage Score 0.5619 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. Homozygous knockout mice for this gene exhibit eyelid defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Some homozygotes for targeted null mutations exhibit open eyes at birth and impaired maternal nuturing. Mutant females for one line exhibit extended gestation length, retarded mammary duct elongation and alveolar morphogenesis, and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Inhbb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Inhbb APN 1 119417983 missense probably benign 0.33
R0091:Inhbb UTSW 1 119417395 missense probably damaging 1.00
R0609:Inhbb UTSW 1 119417416 missense probably damaging 1.00
R1352:Inhbb UTSW 1 119420695 missense probably benign 0.30
R2119:Inhbb UTSW 1 119420701 missense probably benign 0.04
R3964:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R4996:Inhbb UTSW 1 119420818 missense probably damaging 1.00
R5709:Inhbb UTSW 1 119417530 missense probably damaging 0.97
R5973:Inhbb UTSW 1 119418076 missense possibly damaging 0.70
R6376:Inhbb UTSW 1 119417681 missense probably damaging 1.00
R6499:Inhbb UTSW 1 119417339 missense probably damaging 1.00
R6685:Inhbb UTSW 1 119417605 missense probably damaging 1.00
R7158:Inhbb UTSW 1 119421022 nonsense probably null
R7498:Inhbb UTSW 1 119417878 missense probably damaging 1.00
Z1176:Inhbb UTSW 1 119417798 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTCGTCATCAAAGTAGAGCATG -3'
(R):5'- GATGTGCAGTGTGACAGCTG -3'

Sequencing Primer
(F):5'- CATGGACATGGAGCTCAGCTTG -3'
(R):5'- AGTGTGACAGCTGCCAGG -3'
Posted On2015-04-29