Incidental Mutation 'R3966:Ptgs2'
ID312334
Institutional Source Beutler Lab
Gene Symbol Ptgs2
Ensembl Gene ENSMUSG00000032487
Gene Nameprostaglandin-endoperoxide synthase 2
SynonymsCox-2, PHS-2, COX2, prostaglandin G/H synthase, PGHS-2, Pghs2, Tis10, cyclooxygenase 2, cyclooxygenase-2
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.788) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location150100031-150108227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150105475 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 503 (I503N)
Ref Sequence ENSEMBL: ENSMUSP00000035065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035065] [ENSMUST00000190784]
PDB Structure CRYSTAL STRUCTURE OF ARACHIDONIC ACID BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
CYCLOOXYGENASE-2 (PROSTAGLANDIN SYNTHASE-2) COMPLEXED WITH A SELECTIVE INHIBITOR, SC-558 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF A MIXTURE OF ARACHIDONIC ACID AND PROSTAGLANDIN BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2: PROSTAGLANDIN STRUCTURE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF DICLOFENAC BOUND TO THE CYCLOOXYGENASE ACTIVE SITE OF COX-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of eicosapentaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of docosahexaenoic acid bound to the cyclooxygenase channel of cyclooxygenase-2 [X-RAY DIFFRACTION]
X-ray crystal structure of arachidonic acid bound in the cyclooxygenase channel of L531F murine COX-2 [X-RAY DIFFRACTION]
Structure of compound 5c-S bound at the active site of COX-2 [X-RAY DIFFRACTION]
Structure of celecoxib bound at the COX-2 active site [X-RAY DIFFRACTION]
>> 23 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000035065
AA Change: I503N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035065
Gene: ENSMUSG00000032487
AA Change: I503N

DomainStartEndE-ValueType
EGF 20 55 2.64e1 SMART
low complexity region 182 198 N/A INTRINSIC
Pfam:An_peroxidase 206 562 7.3e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190784
SMART Domains Protein: ENSMUSP00000139904
Gene: ENSMUSG00000032487

DomainStartEndE-ValueType
Blast:EGF 1 23 2e-9 BLAST
SCOP:d1eqga2 1 26 5e-8 SMART
PDB:1CVU|B 1 62 1e-38 PDB
SCOP:d1cvua1 27 62 1e-20 SMART
Meta Mutation Damage Score 0.6279 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes an enzyme that is a member of the prostaglandin G/H synthase family. The encoded protein converts arachidonic acid to prostaglandin endoperoxide H2 which is a key enzymatic step in prostaglandin biosynthesis. This gene is the inducible prostaglandin G/H synthase family member that is upregulated during inflammation. Aberrant regulation of this gene is associated with cancer progression in several tissues and an increased risk of cardiovascular events. This gene is the target of many non-steroidal anti-inflammatory drugs. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice exhibit increased perinatal mortality associated with frequent lack of closure and remodeling of the ductus arteriosus, background-sensitive kidney dysplasia with microcyst formation, and myocardial fibrosis. Mutant females show impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Ptgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Ptgs2 APN 1 150104424 missense probably damaging 1.00
IGL01626:Ptgs2 APN 1 150103727 missense probably damaging 1.00
IGL01758:Ptgs2 APN 1 150101989 critical splice acceptor site probably null
IGL02168:Ptgs2 APN 1 150103679 splice site probably null
IGL02309:Ptgs2 APN 1 150105556 missense probably damaging 1.00
IGL02363:Ptgs2 APN 1 150105709 splice site probably null
IGL02574:Ptgs2 APN 1 150102775 nonsense probably null
IGL03156:Ptgs2 APN 1 150105477 missense probably damaging 1.00
R0436:Ptgs2 UTSW 1 150104277 unclassified probably benign
R0629:Ptgs2 UTSW 1 150101037 missense probably benign
R0631:Ptgs2 UTSW 1 150104537 missense probably benign 0.30
R0811:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0812:Ptgs2 UTSW 1 150101354 missense probably benign 0.03
R0980:Ptgs2 UTSW 1 150104310 missense probably damaging 1.00
R1340:Ptgs2 UTSW 1 150105477 missense probably damaging 1.00
R1626:Ptgs2 UTSW 1 150103868 critical splice acceptor site probably null
R1666:Ptgs2 UTSW 1 150101270 missense probably damaging 1.00
R1742:Ptgs2 UTSW 1 150104399 missense probably damaging 1.00
R1926:Ptgs2 UTSW 1 150100228 missense possibly damaging 0.48
R2148:Ptgs2 UTSW 1 150105714 missense probably benign
R2361:Ptgs2 UTSW 1 150103975 missense probably benign 0.00
R2927:Ptgs2 UTSW 1 150101260 missense possibly damaging 0.95
R4291:Ptgs2 UTSW 1 150100251 missense probably benign
R4580:Ptgs2 UTSW 1 150104094 missense possibly damaging 0.78
R4668:Ptgs2 UTSW 1 150101084 missense probably benign 0.32
R4751:Ptgs2 UTSW 1 150104020 missense probably damaging 1.00
R4777:Ptgs2 UTSW 1 150105387 missense probably benign 0.03
R5264:Ptgs2 UTSW 1 150102730 missense possibly damaging 0.62
R5570:Ptgs2 UTSW 1 150104108 missense probably damaging 1.00
R5587:Ptgs2 UTSW 1 150105555 missense probably damaging 1.00
R5761:Ptgs2 UTSW 1 150105528 missense probably benign 0.18
R5850:Ptgs2 UTSW 1 150105376 missense probably benign 0.03
R6137:Ptgs2 UTSW 1 150100993 missense probably benign 0.08
R6513:Ptgs2 UTSW 1 150100128 unclassified probably benign
R6553:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6585:Ptgs2 UTSW 1 150103987 missense possibly damaging 0.93
R6593:Ptgs2 UTSW 1 150101033 missense possibly damaging 0.63
R6772:Ptgs2 UTSW 1 150102078 missense probably damaging 1.00
R6850:Ptgs2 UTSW 1 150105540 missense probably damaging 1.00
R7205:Ptgs2 UTSW 1 150102761 missense probably benign 0.01
R7320:Ptgs2 UTSW 1 150102695 missense probably damaging 1.00
R7567:Ptgs2 UTSW 1 150102697 missense probably damaging 0.99
R7751:Ptgs2 UTSW 1 150104507 missense probably benign 0.14
R7863:Ptgs2 UTSW 1 150101339 missense probably damaging 1.00
R8100:Ptgs2 UTSW 1 150102721 missense probably damaging 1.00
R8117:Ptgs2 UTSW 1 150104034 missense probably damaging 1.00
R8128:Ptgs2 UTSW 1 150101348 missense probably damaging 0.99
Z1176:Ptgs2 UTSW 1 150105721 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCCAGGACAATTGTCAC -3'
(R):5'- CACTTGCATTGATGGTGGC -3'

Sequencing Primer
(F):5'- AGGACAATTGTCACCCGTTC -3'
(R):5'- CTGTGGATCTTGCACATTGAAAG -3'
Posted On2015-04-29