Incidental Mutation 'R3966:Kcnb1'
ID312338
Institutional Source Beutler Lab
Gene Symbol Kcnb1
Ensembl Gene ENSMUSG00000050556
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 1
SynonymsKcr1-1, Shab, Kv2.1
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167095969-167190155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 167104492 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 812 (C812Y)
Ref Sequence ENSEMBL: ENSMUSP00000147093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059826] [ENSMUST00000207917]
Predicted Effect probably damaging
Transcript: ENSMUST00000059826
AA Change: C812Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057981
Gene: ENSMUSG00000050556
AA Change: C812Y

DomainStartEndE-ValueType
BTB 31 140 1.3e-14 SMART
low complexity region 150 162 N/A INTRINSIC
Pfam:Ion_trans 188 424 2.4e-50 PFAM
Pfam:Ion_trans_2 332 418 1.2e-13 PFAM
Pfam:Kv2channel 467 618 5.4e-48 PFAM
low complexity region 698 706 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148226
Predicted Effect probably damaging
Transcript: ENSMUST00000207917
AA Change: C812Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4414 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel and its activity is modulated by some other family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show reduced fasting glucose levels, hyperinsulinemia, improved glucose tolerance, altered glucose-induced electrical activity of pancreatic beta cells, and enhanced insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Kcnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Kcnb1 APN 2 167106207 missense probably damaging 1.00
IGL02945:Kcnb1 APN 2 167188388 missense probably benign 0.03
R0139:Kcnb1 UTSW 2 167105539 missense possibly damaging 0.94
R0144:Kcnb1 UTSW 2 167104547 missense probably damaging 1.00
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0238:Kcnb1 UTSW 2 167104969 missense probably benign 0.04
R0848:Kcnb1 UTSW 2 167106267 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R2869:Kcnb1 UTSW 2 167105935 missense probably damaging 1.00
R3964:Kcnb1 UTSW 2 167104492 missense probably damaging 1.00
R4254:Kcnb1 UTSW 2 167105731 missense probably damaging 1.00
R4418:Kcnb1 UTSW 2 167105675 nonsense probably null
R4625:Kcnb1 UTSW 2 167188233 missense probably damaging 1.00
R4949:Kcnb1 UTSW 2 167105601 missense probably damaging 1.00
R5144:Kcnb1 UTSW 2 167105944 missense probably damaging 1.00
R5249:Kcnb1 UTSW 2 167105183 missense possibly damaging 0.95
R5849:Kcnb1 UTSW 2 167106026 missense probably damaging 1.00
R5869:Kcnb1 UTSW 2 167188071 missense probably benign 0.01
R6108:Kcnb1 UTSW 2 167105140 missense probably damaging 1.00
R6636:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6637:Kcnb1 UTSW 2 167105854 missense probably damaging 0.99
R6880:Kcnb1 UTSW 2 167105807 missense probably damaging 1.00
R7391:Kcnb1 UTSW 2 167105450 missense probably damaging 1.00
R7401:Kcnb1 UTSW 2 167188284 missense probably damaging 0.99
R7651:Kcnb1 UTSW 2 167188361 missense probably damaging 1.00
R7744:Kcnb1 UTSW 2 167188331 missense probably damaging 1.00
R7825:Kcnb1 UTSW 2 167105972 missense probably damaging 1.00
R7848:Kcnb1 UTSW 2 167106268 missense probably damaging 1.00
R7934:Kcnb1 UTSW 2 167104616 missense probably benign 0.03
R8215:Kcnb1 UTSW 2 167104441 missense probably benign 0.43
R8241:Kcnb1 UTSW 2 167106197 missense probably damaging 1.00
R8388:Kcnb1 UTSW 2 167105297 missense probably benign
R8553:Kcnb1 UTSW 2 167104611 missense possibly damaging 0.67
Z1088:Kcnb1 UTSW 2 167188061 missense probably benign 0.38
Z1176:Kcnb1 UTSW 2 167188402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACTTGTCGTGGCTCTC -3'
(R):5'- ATAGACACCGACACTGATGACG -3'

Sequencing Primer
(F):5'- CTTGGGTCTCCGAGTTCACG -3'
(R):5'- CGACACTGATGACGAGGGTC -3'
Posted On2015-04-29