Incidental Mutation 'R3966:Nfatc2'
ID312339
Institutional Source Beutler Lab
Gene Symbol Nfatc2
Ensembl Gene ENSMUSG00000027544
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
SynonymsNFAT1-D, NFATp, NFAT1
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168476410-168601657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 168504549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 875 (S875N)
Ref Sequence ENSEMBL: ENSMUSP00000104812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074618] [ENSMUST00000109184]
Predicted Effect probably benign
Transcript: ENSMUST00000074618
AA Change: S875N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: S875N

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD_DNA_bind 412 572 2.8e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109184
AA Change: S875N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: S875N

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 1.3e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151292
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Nfatc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Nfatc2 APN 2 168504890 missense probably damaging 1.00
IGL01728:Nfatc2 APN 2 168536242 missense probably damaging 1.00
IGL02303:Nfatc2 APN 2 168506901 nonsense probably null
IGL02887:Nfatc2 APN 2 168504450 missense probably damaging 1.00
IGL03002:Nfatc2 APN 2 168534984 missense probably damaging 1.00
IGL03297:Nfatc2 APN 2 168536218 missense probably damaging 0.99
R0347:Nfatc2 UTSW 2 168536290 missense probably damaging 1.00
R0590:Nfatc2 UTSW 2 168571199 missense probably damaging 0.99
R0631:Nfatc2 UTSW 2 168590115 missense probably benign 0.02
R1019:Nfatc2 UTSW 2 168504879 missense probably damaging 1.00
R1183:Nfatc2 UTSW 2 168590088 missense possibly damaging 0.83
R1420:Nfatc2 UTSW 2 168504665 missense probably benign 0.01
R1977:Nfatc2 UTSW 2 168504459 missense possibly damaging 0.68
R2306:Nfatc2 UTSW 2 168590103 missense probably damaging 1.00
R3034:Nfatc2 UTSW 2 168535020 missense probably damaging 1.00
R3176:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3276:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3964:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R4669:Nfatc2 UTSW 2 168571490 missense probably benign
R4864:Nfatc2 UTSW 2 168536392 missense probably damaging 0.96
R4951:Nfatc2 UTSW 2 168571072 missense probably damaging 0.98
R5138:Nfatc2 UTSW 2 168536309 missense probably damaging 1.00
R5145:Nfatc2 UTSW 2 168590067 missense probably benign 0.25
R5185:Nfatc2 UTSW 2 168570707 missense possibly damaging 0.48
R5444:Nfatc2 UTSW 2 168534890 intron probably benign
R5496:Nfatc2 UTSW 2 168536278 missense probably damaging 1.00
R5728:Nfatc2 UTSW 2 168480249 missense probably benign
R5791:Nfatc2 UTSW 2 168536393 missense probably benign 0.28
R6102:Nfatc2 UTSW 2 168519507 intron probably benign
R6157:Nfatc2 UTSW 2 168519451 intron probably benign
R6187:Nfatc2 UTSW 2 168480238 missense probably benign 0.13
R7116:Nfatc2 UTSW 2 168507349 missense probably benign 0.04
R7218:Nfatc2 UTSW 2 168571264 missense probably benign 0.01
R7470:Nfatc2 UTSW 2 168523307 nonsense probably null
R7594:Nfatc2 UTSW 2 168523348 missense probably damaging 1.00
R7618:Nfatc2 UTSW 2 168534999 missense probably damaging 1.00
R7653:Nfatc2 UTSW 2 168571145 missense probably benign 0.01
R8425:Nfatc2 UTSW 2 168536296 missense probably damaging 1.00
R8485:Nfatc2 UTSW 2 168590092 missense probably damaging 1.00
R8791:Nfatc2 UTSW 2 168536294 missense probably damaging 0.99
Z1176:Nfatc2 UTSW 2 168571349 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTCAAGTTAAAATGGAGGTACG -3'
(R):5'- AGAAGCAAGAGCCTGAGTCC -3'

Sequencing Primer
(F):5'- TTAAAATGGAGGTACGGAGGC -3'
(R):5'- CATGCTGGTTCTCAGGGGC -3'
Posted On2015-04-29