Incidental Mutation 'R3966:Tet2'
ID312340
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
MMRRC Submission 040935-MU
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133487657 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 339 (S339P)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: S339P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: S339P

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: S339P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: S339P

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197118
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1455:Tet2 UTSW 3 133473645 missense possibly damaging 0.51
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
R7978:Tet2 UTSW 3 133487665 missense possibly damaging 0.96
R8055:Tet2 UTSW 3 133467992 missense possibly damaging 0.93
R8164:Tet2 UTSW 3 133467134 missense possibly damaging 0.85
R8236:Tet2 UTSW 3 133487786 missense probably benign 0.00
R8755:Tet2 UTSW 3 133488278 missense probably damaging 0.99
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTCATGGTGTTCTTCCAAAGC -3'
(R):5'- TGACTAAGGCCTGTGATGCTG -3'

Sequencing Primer
(F):5'- AGCTACATCATTTAGAGCGCC -3'
(R):5'- CCTGTGATGCTGATAATGCCAG -3'
Posted On2015-04-29