Incidental Mutation 'R3966:Trp73'
ID312344
Institutional Source Beutler Lab
Gene Symbol Trp73
Ensembl Gene ENSMUSG00000029026
Gene Nametransformation related protein 73
SynonymsdeltaNp73, p73, TAp73
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154056253-154140208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154062036 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 422 (V422A)
Ref Sequence ENSEMBL: ENSMUSP00000101269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097762] [ENSMUST00000097763] [ENSMUST00000105643] [ENSMUST00000105644] [ENSMUST00000133533] [ENSMUST00000155642]
Predicted Effect probably benign
Transcript: ENSMUST00000097762
SMART Domains Protein: ENSMUSP00000095368
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 2.6e-111 PFAM
Pfam:P53_tetramer 296 337 8.5e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Pfam:SAM_2 352 406 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097763
SMART Domains Protein: ENSMUSP00000134196
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 64 260 6.4e-112 PFAM
Pfam:P53_tetramer 296 337 2.3e-21 PFAM
low complexity region 341 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105643
AA Change: V374A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000101268
Gene: ENSMUSG00000029026
AA Change: V374A

DomainStartEndE-ValueType
Pfam:P53 64 260 2.1e-111 PFAM
Pfam:P53_tetramer 296 337 7.6e-21 PFAM
low complexity region 342 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105644
AA Change: V422A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101269
Gene: ENSMUSG00000029026
AA Change: V422A

DomainStartEndE-ValueType
Pfam:P53 112 308 3.1e-115 PFAM
Pfam:P53_tetramer 344 383 8.3e-21 PFAM
low complexity region 390 398 N/A INTRINSIC
SAM 486 552 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133533
AA Change: V374A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000114418
Gene: ENSMUSG00000029026
AA Change: V374A

DomainStartEndE-ValueType
Pfam:P53 64 260 3.8e-111 PFAM
Pfam:P53_tetramer 296 337 1.1e-20 PFAM
low complexity region 342 350 N/A INTRINSIC
SAM 438 504 2.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155642
SMART Domains Protein: ENSMUSP00000135281
Gene: ENSMUSG00000029026

DomainStartEndE-ValueType
Pfam:P53 42 213 1.3e-94 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: This gene encodes tumor protein p73, which is a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include p53, p63, and p73 and have high sequence similarity to one another, which allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways involving direct or indirect protein interactions, resulting in regulation of the same target gene promoters or regulation of each other's promoters. The p73 protein is expressed at very low levels in normal tissues and is differentially expressed in a number of tumors. The p73 gene expresses at least 35 mRNA variants due to the use of alternate promoters, alternate translation initiation sites, and multiple splice variations. Theoretically this can account for 29 different p73 isoforms; however, the biological validity and the full-length nature of most variants have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice display a variety of defects including hippocampal dysgenesis, hydrocephalus, chronic infections and inflammation, abnormal pheromone sensory pathways, eye abnormalities, impaired growth, and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Trp73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02150:Trp73 APN 4 154081486 missense possibly damaging 0.82
IGL02264:Trp73 APN 4 154064428 missense probably null 0.98
IGL02344:Trp73 APN 4 154062043 missense possibly damaging 0.92
IGL02663:Trp73 APN 4 154062506 splice site probably null
IGL02956:Trp73 APN 4 154064463 splice site probably benign
IGL03093:Trp73 APN 4 154104873 missense probably benign 0.00
slowpoke UTSW 4 154064632 splice site probably null
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0238:Trp73 UTSW 4 154062524 unclassified probably benign
R0363:Trp73 UTSW 4 154063949 missense probably benign 0.17
R0409:Trp73 UTSW 4 154064384 missense possibly damaging 0.81
R1161:Trp73 UTSW 4 154081323 splice site probably null
R1531:Trp73 UTSW 4 154063895 missense probably benign 0.31
R2002:Trp73 UTSW 4 154081445 missense probably damaging 1.00
R2185:Trp73 UTSW 4 154104817 critical splice donor site probably null
R3965:Trp73 UTSW 4 154062036 missense probably benign 0.03
R4247:Trp73 UTSW 4 154064632 splice site probably null
R4595:Trp73 UTSW 4 154064417 missense probably damaging 0.99
R5170:Trp73 UTSW 4 154104838 missense possibly damaging 0.95
R5260:Trp73 UTSW 4 154062602 missense possibly damaging 0.48
R5622:Trp73 UTSW 4 154060592 missense possibly damaging 0.68
R6173:Trp73 UTSW 4 154104341 missense probably damaging 1.00
R6252:Trp73 UTSW 4 154064397 missense probably damaging 1.00
R6950:Trp73 UTSW 4 154062053 missense probably benign 0.18
R7043:Trp73 UTSW 4 154067007 splice site probably null
R7050:Trp73 UTSW 4 154081442 missense probably damaging 1.00
R7052:Trp73 UTSW 4 154064683 missense probably damaging 0.98
R7620:Trp73 UTSW 4 154059257 nonsense probably null
R8086:Trp73 UTSW 4 154116595 missense unknown
Z1176:Trp73 UTSW 4 154067012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGCCTCCATAGCCATTG -3'
(R):5'- AGAGGCAGGGTCTACATCTAC -3'

Sequencing Primer
(F):5'- AGGTGGCCATCAAAGGTCC -3'
(R):5'- GCAGGGTCTACATCTACCTGCATC -3'
Posted On2015-04-29