Incidental Mutation 'R3966:Tom1'
ID312353
Institutional Source Beutler Lab
Gene Symbol Tom1
Ensembl Gene ENSMUSG00000042870
Gene Nametarget of myb1 trafficking protein
Synonyms
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location75033705-75070121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75059239 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 360 (K360E)
Ref Sequence ENSEMBL: ENSMUSP00000077891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078847] [ENSMUST00000165630] [ENSMUST00000212388] [ENSMUST00000212651]
Predicted Effect probably benign
Transcript: ENSMUST00000078847
AA Change: K360E

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077891
Gene: ENSMUSG00000042870
AA Change: K360E

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 228 303 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165630
SMART Domains Protein: ENSMUSP00000130854
Gene: ENSMUSG00000042870

DomainStartEndE-ValueType
VHS 13 148 4.03e-68 SMART
Pfam:GAT 212 312 5.1e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212278
Predicted Effect probably benign
Transcript: ENSMUST00000212388
Predicted Effect probably benign
Transcript: ENSMUST00000212651
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a target of the v-myb oncogene. The encoded protein shares its N-terminal domain in common with proteins associated with vesicular trafficking at the endosome. It is recruited to the endosomes by its interaction with endofin. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Tom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Tom1 APN 8 75052174 missense probably benign 0.27
IGL00979:Tom1 APN 8 75054703 unclassified probably benign
IGL01143:Tom1 APN 8 75058457 missense probably benign 0.00
IGL02825:Tom1 APN 8 75057255 missense probably damaging 1.00
R0335:Tom1 UTSW 8 75064392 critical splice acceptor site probably null
R0762:Tom1 UTSW 8 75052306 splice site probably benign
R1317:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1509:Tom1 UTSW 8 75054631 missense probably damaging 1.00
R1691:Tom1 UTSW 8 75051599 missense probably damaging 1.00
R1761:Tom1 UTSW 8 75051551 missense probably benign 0.03
R1906:Tom1 UTSW 8 75051590 missense probably damaging 1.00
R5004:Tom1 UTSW 8 75052002 missense probably damaging 1.00
R5513:Tom1 UTSW 8 75057220 missense probably damaging 0.99
R5906:Tom1 UTSW 8 75050258 missense probably damaging 1.00
R6147:Tom1 UTSW 8 75054692 missense possibly damaging 0.90
R6964:Tom1 UTSW 8 75051965 missense probably null 1.00
R7010:Tom1 UTSW 8 75051975 missense probably damaging 0.98
R7131:Tom1 UTSW 8 75057249 missense possibly damaging 0.88
R7147:Tom1 UTSW 8 75057267 missense probably damaging 1.00
R8701:Tom1 UTSW 8 75052168 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATCCCAAGCCAAATCTTGC -3'
(R):5'- GAAACCAAGCTGGAGTTTAACTC -3'

Sequencing Primer
(F):5'- CAAATCTTGCTACAGGATTGGGC -3'
(R):5'- CTCAGTGGCAAAAATATTGTCTAGC -3'
Posted On2015-04-29