Incidental Mutation 'R3966:Npm1'
ID312358
Institutional Source Beutler Lab
Gene Symbol Npm1
Ensembl Gene ENSMUSG00000057113
Gene Namenucleophosmin 1
Synonymsnucleolar protein NO38, B23, NO38
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3966 (G1)
Quality Score184
Status Validated
Chromosome11
Chromosomal Location33152287-33163206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33160350 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 148 (G148D)
Ref Sequence ENSEMBL: ENSMUSP00000098926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075641] [ENSMUST00000093201] [ENSMUST00000101375] [ENSMUST00000109354]
Predicted Effect probably benign
Transcript: ENSMUST00000075641
AA Change: G148D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075067
Gene: ENSMUSG00000057113
AA Change: G148D

DomainStartEndE-ValueType
Pfam:Nucleoplasmin 15 193 8.7e-73 PFAM
Pfam:NPM1-C 243 291 1.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093201
AA Change: G148D

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000090891
Gene: ENSMUSG00000057113
AA Change: G148D

DomainStartEndE-ValueType
Pfam:Nucleoplasmin 13 195 6.1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101375
AA Change: G148D

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098926
Gene: ENSMUSG00000057113
AA Change: G148D

DomainStartEndE-ValueType
Pfam:Nucleoplasmin 15 193 1e-72 PFAM
PDB:2LLH|A 223 255 2e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000109354
AA Change: G148D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000104978
Gene: ENSMUSG00000057113
AA Change: G148D

DomainStartEndE-ValueType
Pfam:Nucleoplasmin 13 195 5e-58 PFAM
PDB:2LLH|A 223 255 1e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146759
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein which moves between the nucleus and the cytoplasm. The gene product is thought to be involved in several processes including regulation of the ARF/p53 pathway. A number of genes are fusion partners have been characterized, in particular the anaplastic lymphoma kinase gene on chromosome 2. Mutations in this gene are associated with acute myeloid leukemia. More than a dozen pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality, anemia, defects in primitive hematopoeisis and abnormal brain development. Heterozygous mutation results in hematopoeisis defects and chromosomal instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Npm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03233:Npm1 APN 11 33156717 missense probably benign 0.24
R3959:Npm1 UTSW 11 33154012 missense probably damaging 1.00
R7895:Npm1 UTSW 11 33156001 critical splice donor site probably null
V5622:Npm1 UTSW 11 33161186 missense probably benign 0.39
Z1176:Npm1 UTSW 11 33160831 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTGATTAGCCAAAGTAAATGCC -3'
(R):5'- GGACTGTCGTAGTTCTACAAAGACC -3'

Sequencing Primer
(F):5'- TGGAACTCACTTTGTAGACCAC -3'
(R):5'- GTTCTACAAAGACCTGATTTCTGTC -3'
Posted On2015-04-29