Incidental Mutation 'R3966:Ctc1'
ID312361
Institutional Source Beutler Lab
Gene Symbol Ctc1
Ensembl Gene ENSMUSG00000020898
Gene NameCTS telomere maintenance complex component 1
Synonyms
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69015911-69036473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69031128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 800 (V800D)
Ref Sequence ENSEMBL: ENSMUSP00000112063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021278] [ENSMUST00000116359] [ENSMUST00000152979] [ENSMUST00000161455]
Predicted Effect probably damaging
Transcript: ENSMUST00000021278
AA Change: V800D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021278
Gene: ENSMUSG00000020898
AA Change: V800D

DomainStartEndE-ValueType
Pfam:CTC1 60 1195 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116359
AA Change: V800D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112063
Gene: ENSMUSG00000020898
AA Change: V800D

DomainStartEndE-ValueType
Pfam:CTC1 61 1196 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143404
Predicted Effect probably benign
Transcript: ENSMUST00000152979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161384
Predicted Effect possibly damaging
Transcript: ENSMUST00000161455
AA Change: V554D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124702
Gene: ENSMUSG00000020898
AA Change: V554D

DomainStartEndE-ValueType
Pfam:CTC1 1 949 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162256
Meta Mutation Damage Score 0.4374 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit defective telomere replication that leads to stem cell exhaustion, bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Ctc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Ctc1 APN 11 69031149 missense probably damaging 1.00
IGL02135:Ctc1 APN 11 69021163 missense probably benign 0.25
IGL02164:Ctc1 APN 11 69026096 missense probably damaging 0.99
IGL02337:Ctc1 APN 11 69026131 missense probably damaging 1.00
IGL03149:Ctc1 APN 11 69031161 missense possibly damaging 0.55
PIT4810001:Ctc1 UTSW 11 69022526 missense probably benign 0.38
R0295:Ctc1 UTSW 11 69030588 missense possibly damaging 0.75
R0320:Ctc1 UTSW 11 69033537 missense probably damaging 1.00
R0496:Ctc1 UTSW 11 69035507 missense probably damaging 1.00
R1497:Ctc1 UTSW 11 69022561 missense probably benign 0.00
R1607:Ctc1 UTSW 11 69036150 missense possibly damaging 0.82
R1623:Ctc1 UTSW 11 69021142 missense probably damaging 0.99
R1856:Ctc1 UTSW 11 69034658 missense probably damaging 1.00
R1876:Ctc1 UTSW 11 69031564 missense probably benign 0.24
R1967:Ctc1 UTSW 11 69027862 critical splice acceptor site probably null
R2164:Ctc1 UTSW 11 69035615 missense possibly damaging 0.92
R2348:Ctc1 UTSW 11 69026191 missense probably benign 0.43
R2428:Ctc1 UTSW 11 69027701 missense possibly damaging 0.51
R3964:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3965:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R4398:Ctc1 UTSW 11 69022871 missense probably damaging 1.00
R4508:Ctc1 UTSW 11 69016117 splice site probably null
R4605:Ctc1 UTSW 11 69029726 missense possibly damaging 0.86
R4976:Ctc1 UTSW 11 69027326 missense probably damaging 1.00
R4979:Ctc1 UTSW 11 69033502 missense probably damaging 1.00
R5268:Ctc1 UTSW 11 69029810 missense possibly damaging 0.67
R6023:Ctc1 UTSW 11 69022607 missense probably benign 0.00
R6053:Ctc1 UTSW 11 69027901 missense probably benign 0.01
R7204:Ctc1 UTSW 11 69029741 missense probably damaging 1.00
R7252:Ctc1 UTSW 11 69026174 missense probably damaging 1.00
R7357:Ctc1 UTSW 11 69034742 missense probably benign 0.17
R7654:Ctc1 UTSW 11 69026215 missense probably damaging 1.00
R7724:Ctc1 UTSW 11 69026344 missense probably benign 0.00
R7890:Ctc1 UTSW 11 69026529 missense probably damaging 1.00
R7979:Ctc1 UTSW 11 69027383 nonsense probably null
R8042:Ctc1 UTSW 11 69029843 intron probably benign
R8167:Ctc1 UTSW 11 69027758 missense probably damaging 1.00
R8179:Ctc1 UTSW 11 69024224 missense probably benign 0.18
R8353:Ctc1 UTSW 11 69022449 missense probably benign 0.03
R8453:Ctc1 UTSW 11 69022449 missense probably benign 0.03
R8465:Ctc1 UTSW 11 69026219 missense probably damaging 1.00
R8948:Ctc1 UTSW 11 69026349 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCACGTGTCAGGAACTTGG -3'
(R):5'- TACAGACAGACGATTCAGTCCC -3'

Sequencing Primer
(F):5'- CACGTGTCAGGAACTTGGCTTTG -3'
(R):5'- AGACGATTCAGTCCCCCTAAATTCTG -3'
Posted On2015-04-29