Incidental Mutation 'R3966:Prkd1'
ID312363
Institutional Source Beutler Lab
Gene Symbol Prkd1
Ensembl Gene ENSMUSG00000002688
Gene Nameprotein kinase D1
SynonymsPrkcm, Pkcm, PKD1
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location50341231-50649098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 50392941 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 368 (E368K)
Ref Sequence ENSEMBL: ENSMUSP00000002765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002765]
Predicted Effect probably benign
Transcript: ENSMUST00000002765
AA Change: E368K

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002765
Gene: ENSMUSG00000002688
AA Change: E368K

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
C1 138 194 1.36e-12 SMART
C1 277 326 5.95e-18 SMART
PH 429 549 5.33e-9 SMART
S_TKc 589 845 1.24e-92 SMART
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase involved in many cellular processes, including Golgi body membrane integrity and transport, cell migration and differentiation, MAPK8/JNK1 and Ras pathway signaling, MAPK1/3 (ERK1/2) pathway signaling, cell survival, and regulation of cell shape and adhesion. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial embryonic lethality. Mice homozygous for a knock-in allele display partial embryonic and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Prkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Prkd1 APN 12 50383481 missense probably damaging 1.00
IGL00727:Prkd1 APN 12 50364661 missense probably damaging 1.00
IGL00772:Prkd1 APN 12 50383416 missense probably damaging 0.99
IGL01092:Prkd1 APN 12 50383515 splice site probably benign
IGL01457:Prkd1 APN 12 50392910 nonsense probably null
IGL01538:Prkd1 APN 12 50342142 missense probably benign
IGL01762:Prkd1 APN 12 50387230 missense probably benign 0.00
IGL01876:Prkd1 APN 12 50366348 missense probably damaging 1.00
IGL01973:Prkd1 APN 12 50366379 missense probably damaging 1.00
IGL02086:Prkd1 APN 12 50387263 missense probably benign
IGL02293:Prkd1 APN 12 50489978 missense probably damaging 0.97
IGL02454:Prkd1 APN 12 50364673 missense probably benign 0.09
IGL03309:Prkd1 APN 12 50388424 missense probably damaging 1.00
R0349:Prkd1 UTSW 12 50366356 missense probably damaging 1.00
R0457:Prkd1 UTSW 12 50366372 missense probably damaging 0.99
R0627:Prkd1 UTSW 12 50490041 missense probably benign 0.00
R0899:Prkd1 UTSW 12 50385193 missense probably damaging 0.98
R1219:Prkd1 UTSW 12 50388342 missense probably damaging 1.00
R1495:Prkd1 UTSW 12 50366352 missense probably damaging 1.00
R1584:Prkd1 UTSW 12 50425515 missense probably damaging 1.00
R1665:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1666:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1668:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1669:Prkd1 UTSW 12 50394926 missense probably damaging 1.00
R1735:Prkd1 UTSW 12 50342039 missense possibly damaging 0.79
R1939:Prkd1 UTSW 12 50394994 missense probably benign 0.00
R2143:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R2145:Prkd1 UTSW 12 50489911 missense possibly damaging 0.77
R3404:Prkd1 UTSW 12 50648904 missense unknown
R3801:Prkd1 UTSW 12 50383422 missense possibly damaging 0.89
R3818:Prkd1 UTSW 12 50419884 splice site probably benign
R3906:Prkd1 UTSW 12 50388426 missense possibly damaging 0.91
R4179:Prkd1 UTSW 12 50366448 missense probably damaging 1.00
R4510:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4511:Prkd1 UTSW 12 50392979 missense possibly damaging 0.81
R4663:Prkd1 UTSW 12 50419848 splice site probably null
R4896:Prkd1 UTSW 12 50389962 missense probably damaging 1.00
R5070:Prkd1 UTSW 12 50394622 nonsense probably null
R5263:Prkd1 UTSW 12 50388306 missense probably damaging 1.00
R5389:Prkd1 UTSW 12 50343137 missense probably damaging 1.00
R5395:Prkd1 UTSW 12 50391432 missense probably damaging 1.00
R5855:Prkd1 UTSW 12 50392916 missense probably benign 0.03
R5967:Prkd1 UTSW 12 50364550 missense probably damaging 0.99
R5973:Prkd1 UTSW 12 50388255 missense probably damaging 0.99
R6052:Prkd1 UTSW 12 50366300 critical splice donor site probably null
R6063:Prkd1 UTSW 12 50342043 missense probably benign 0.02
R6309:Prkd1 UTSW 12 50394660 nonsense probably null
R6518:Prkd1 UTSW 12 50425495 missense probably benign 0.08
R6868:Prkd1 UTSW 12 50425537 missense probably damaging 1.00
R7256:Prkd1 UTSW 12 50388342 missense possibly damaging 0.88
R7346:Prkd1 UTSW 12 50648834 missense possibly damaging 0.86
R7815:Prkd1 UTSW 12 50425517 missense probably damaging 1.00
R8290:Prkd1 UTSW 12 50342016 missense probably damaging 1.00
R8397:Prkd1 UTSW 12 50392892 missense probably benign
X0024:Prkd1 UTSW 12 50489974 missense probably benign 0.31
X0062:Prkd1 UTSW 12 50394922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTTCTCTGGGGCAAC -3'
(R):5'- TTAGGATTGCCTTTCCCCTAAAG -3'

Sequencing Primer
(F):5'- TCCGTAAGCTTTCCTATACAGAAC -3'
(R):5'- TAAAGCCCTGGTTCTAAGAGTCCG -3'
Posted On2015-04-29