Incidental Mutation 'R3966:Clptm1l'
ID312365
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene NameCLPTM1-like
SynonymsC130052I12Rik
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73604006-73620605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73615972 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 404 (Y404H)
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
Predicted Effect probably damaging
Transcript: ENSMUST00000022102
AA Change: Y404H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: Y404H

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222343
Meta Mutation Damage Score 0.5404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73607873 splice site probably null
IGL01963:Clptm1l APN 13 73617569 splice site probably benign
IGL02169:Clptm1l APN 13 73611663 missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73607760 missense probably benign 0.07
IGL02596:Clptm1l APN 13 73613666 missense probably benign 0.02
IGL02720:Clptm1l APN 13 73614602 splice site probably benign
IGL03100:Clptm1l APN 13 73612390 splice site probably benign
P0023:Clptm1l UTSW 13 73604952 missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73611667 missense possibly damaging 0.67
R0725:Clptm1l UTSW 13 73606343 missense probably benign
R1572:Clptm1l UTSW 13 73607747 missense probably benign
R1589:Clptm1l UTSW 13 73614673 critical splice donor site probably null
R2062:Clptm1l UTSW 13 73607723 nonsense probably null
R2064:Clptm1l UTSW 13 73607723 nonsense probably null
R2065:Clptm1l UTSW 13 73607723 nonsense probably null
R2067:Clptm1l UTSW 13 73607723 nonsense probably null
R2068:Clptm1l UTSW 13 73607723 nonsense probably null
R3003:Clptm1l UTSW 13 73617756 missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73616038 missense probably benign 0.21
R3808:Clptm1l UTSW 13 73612454 missense probably benign 0.13
R4615:Clptm1l UTSW 13 73607738 nonsense probably null
R4801:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73611196 missense possibly damaging 0.52
R4957:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R5864:Clptm1l UTSW 13 73606284 missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73617765 critical splice donor site probably null
R6701:Clptm1l UTSW 13 73608906 missense probably benign 0.00
R6720:Clptm1l UTSW 13 73618516 missense probably damaging 1.00
R7782:Clptm1l UTSW 13 73604320 missense probably damaging 1.00
R8292:Clptm1l UTSW 13 73617735 missense probably damaging 0.96
R8329:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCAGAATTCCATGGCC -3'
(R):5'- GGCCTGTATCTGAGAAGAGTCC -3'

Sequencing Primer
(F):5'- CTTGGCAGAATTCCATGGCCATTAG -3'
(R):5'- ATCTGAGAAGAGTCCTGAGTTCC -3'
Posted On2015-04-29