Incidental Mutation 'R3966:Clptm1l'
ID 312365
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene Name CLPTM1-like
Synonyms C130052I12Rik
MMRRC Submission 040935-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3966 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 73752125-73768724 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73764091 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 404 (Y404H)
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
AlphaFold Q8BXA5
Predicted Effect probably damaging
Transcript: ENSMUST00000022102
AA Change: Y404H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: Y404H

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222343
Meta Mutation Damage Score 0.5404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 T C 1: 89,762,183 (GRCm39) I371T probably damaging Het
Brwd1 G A 16: 95,845,730 (GRCm39) T731I probably damaging Het
C1galt1c1 A T X: 37,720,453 (GRCm39) V181E probably benign Het
C3 A G 17: 57,525,664 (GRCm39) V864A probably damaging Het
Cadps A T 14: 12,522,161 (GRCm38) probably null Het
Cemip T A 7: 83,600,717 (GRCm39) Y968F probably benign Het
Ces1g C A 8: 94,055,139 (GRCm39) R186L possibly damaging Het
Chd2 A G 7: 73,114,143 (GRCm39) probably benign Het
CN725425 T A 15: 91,126,890 (GRCm39) probably null Het
Ctc1 T A 11: 68,921,954 (GRCm39) V800D probably damaging Het
Cyp1a1 T A 9: 57,607,432 (GRCm39) V20D probably benign Het
E330034G19Rik G T 14: 24,356,939 (GRCm39) M158I unknown Het
Ehbp1l1 C T 19: 5,760,601 (GRCm39) probably null Het
Gm14137 T A 2: 119,005,497 (GRCm39) S19T probably benign Het
Gpr141b A G 13: 19,913,614 (GRCm39) noncoding transcript Het
Gprc6a CAAA CA 10: 51,491,776 (GRCm39) probably null Het
Inhbb C A 1: 119,345,291 (GRCm39) G333W probably damaging Het
Kcnb1 C T 2: 166,946,412 (GRCm39) C812Y probably damaging Het
Kdm4c A G 4: 74,216,820 (GRCm39) D193G probably damaging Het
Mbd5 A T 2: 49,162,082 (GRCm39) I855L possibly damaging Het
Mcpt1 G A 14: 56,256,503 (GRCm39) V80M probably benign Het
Med31 C T 11: 72,102,755 (GRCm39) A118T probably benign Het
Megf10 A G 18: 57,313,646 (GRCm39) D30G probably damaging Het
Ms4a6b T C 19: 11,499,098 (GRCm39) S71P probably benign Het
Muc2 G A 7: 141,286,233 (GRCm39) R120H probably benign Het
Mycbp2 A G 14: 103,376,161 (GRCm39) probably benign Het
Myrf T C 19: 10,196,979 (GRCm39) E267G probably benign Het
Ncor1 T C 11: 62,235,583 (GRCm39) T624A probably damaging Het
Nfat5 G T 8: 108,093,921 (GRCm39) A721S possibly damaging Het
Nfatc2 C T 2: 168,346,469 (GRCm39) S875N probably benign Het
Npm1 C T 11: 33,110,350 (GRCm39) G148D probably benign Het
Nrap T C 19: 56,330,576 (GRCm39) S1126G probably damaging Het
Nucb2 A G 7: 116,128,110 (GRCm39) E273G probably damaging Het
Prkd1 C T 12: 50,439,724 (GRCm39) E368K probably benign Het
Ptgs2 T A 1: 149,981,226 (GRCm39) I503N probably damaging Het
Qrfpr A G 3: 36,235,149 (GRCm39) S243P possibly damaging Het
Safb2 T C 17: 56,882,356 (GRCm39) S426G probably null Het
Sos1 C T 17: 80,762,608 (GRCm39) R73H probably damaging Het
Spink10 T C 18: 62,790,975 (GRCm39) I87T probably damaging Het
Tet2 A G 3: 133,193,418 (GRCm39) S339P possibly damaging Het
Timd5 T A 11: 46,426,340 (GRCm39) V149D possibly damaging Het
Tmx4 T C 2: 134,441,981 (GRCm39) I206V possibly damaging Het
Tom1 A G 8: 75,785,867 (GRCm39) K360E probably benign Het
Trp73 A G 4: 154,146,493 (GRCm39) V422A probably benign Het
Vmn2r33 T C 7: 7,557,168 (GRCm39) M511V probably benign Het
Zfp628 T C 7: 4,924,744 (GRCm39) S989P probably benign Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73,755,992 (GRCm39) splice site probably null
IGL01963:Clptm1l APN 13 73,765,688 (GRCm39) splice site probably benign
IGL02169:Clptm1l APN 13 73,759,782 (GRCm39) missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73,755,879 (GRCm39) missense probably benign 0.07
IGL02596:Clptm1l APN 13 73,761,785 (GRCm39) missense probably benign 0.02
IGL02720:Clptm1l APN 13 73,762,721 (GRCm39) splice site probably benign
IGL03100:Clptm1l APN 13 73,760,509 (GRCm39) splice site probably benign
P0023:Clptm1l UTSW 13 73,753,071 (GRCm39) missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73,759,786 (GRCm39) missense possibly damaging 0.67
R0725:Clptm1l UTSW 13 73,754,462 (GRCm39) missense probably benign
R1572:Clptm1l UTSW 13 73,755,866 (GRCm39) missense probably benign
R1589:Clptm1l UTSW 13 73,762,792 (GRCm39) critical splice donor site probably null
R2062:Clptm1l UTSW 13 73,755,842 (GRCm39) nonsense probably null
R2064:Clptm1l UTSW 13 73,755,842 (GRCm39) nonsense probably null
R2065:Clptm1l UTSW 13 73,755,842 (GRCm39) nonsense probably null
R2067:Clptm1l UTSW 13 73,755,842 (GRCm39) nonsense probably null
R2068:Clptm1l UTSW 13 73,755,842 (GRCm39) nonsense probably null
R3003:Clptm1l UTSW 13 73,765,875 (GRCm39) missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73,764,157 (GRCm39) missense probably benign 0.21
R3808:Clptm1l UTSW 13 73,760,573 (GRCm39) missense probably benign 0.13
R4615:Clptm1l UTSW 13 73,755,857 (GRCm39) nonsense probably null
R4801:Clptm1l UTSW 13 73,755,981 (GRCm39) missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73,755,981 (GRCm39) missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73,760,547 (GRCm39) missense probably damaging 1.00
R4957:Clptm1l UTSW 13 73,759,315 (GRCm39) missense possibly damaging 0.52
R5864:Clptm1l UTSW 13 73,754,403 (GRCm39) missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73,765,884 (GRCm39) critical splice donor site probably null
R6701:Clptm1l UTSW 13 73,757,025 (GRCm39) missense probably benign 0.00
R6720:Clptm1l UTSW 13 73,766,635 (GRCm39) missense probably damaging 1.00
R7782:Clptm1l UTSW 13 73,752,439 (GRCm39) missense probably damaging 1.00
R8292:Clptm1l UTSW 13 73,765,854 (GRCm39) missense probably damaging 0.96
R8329:Clptm1l UTSW 13 73,760,547 (GRCm39) missense probably damaging 1.00
R9224:Clptm1l UTSW 13 73,752,344 (GRCm39) start gained probably benign
R9528:Clptm1l UTSW 13 73,760,550 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCTTGGCAGAATTCCATGGCC -3'
(R):5'- GGCCTGTATCTGAGAAGAGTCC -3'

Sequencing Primer
(F):5'- CTTGGCAGAATTCCATGGCCATTAG -3'
(R):5'- ATCTGAGAAGAGTCCTGAGTTCC -3'
Posted On 2015-04-29