Incidental Mutation 'R3966:E330034G19Rik'
ID312367
Institutional Source Beutler Lab
Gene Symbol E330034G19Rik
Ensembl Gene ENSMUSG00000038925
Gene NameRIKEN cDNA E330034G19 gene
Synonyms
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location24293214-24309966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24306871 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 158 (M158I)
Ref Sequence ENSEMBL: ENSMUSP00000123912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161740] [ENSMUST00000162224] [ENSMUST00000163055]
Predicted Effect unknown
Transcript: ENSMUST00000041413
AA Change: M223I
SMART Domains Protein: ENSMUSP00000040386
Gene: ENSMUSG00000038925
AA Change: M223I

DomainStartEndE-ValueType
coiled coil region 78 131 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
coiled coil region 207 325 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161740
AA Change: M223I
SMART Domains Protein: ENSMUSP00000124917
Gene: ENSMUSG00000038925
AA Change: M223I

DomainStartEndE-ValueType
coiled coil region 100 153 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
coiled coil region 229 347 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000162224
AA Change: M154I
SMART Domains Protein: ENSMUSP00000124926
Gene: ENSMUSG00000038925
AA Change: M154I

DomainStartEndE-ValueType
coiled coil region 13 66 N/A INTRINSIC
low complexity region 89 107 N/A INTRINSIC
coiled coil region 136 256 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163055
AA Change: M158I
SMART Domains Protein: ENSMUSP00000123912
Gene: ENSMUSG00000038925
AA Change: M158I

DomainStartEndE-ValueType
coiled coil region 13 66 N/A INTRINSIC
low complexity region 89 107 N/A INTRINSIC
coiled coil region 142 181 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in E330034G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:E330034G19Rik APN 14 24297984 missense possibly damaging 0.89
R0565:E330034G19Rik UTSW 14 24306917 missense probably benign 0.27
R1507:E330034G19Rik UTSW 14 24306987 missense possibly damaging 0.46
R1819:E330034G19Rik UTSW 14 24298013 missense probably damaging 0.99
R3158:E330034G19Rik UTSW 14 24296897 missense possibly damaging 0.79
R4621:E330034G19Rik UTSW 14 24296002 utr 5 prime probably benign
R4992:E330034G19Rik UTSW 14 24306996 missense unknown
R5567:E330034G19Rik UTSW 14 24296824 missense possibly damaging 0.94
R5570:E330034G19Rik UTSW 14 24296824 missense possibly damaging 0.94
R5630:E330034G19Rik UTSW 14 24308268 unclassified probably benign
R6062:E330034G19Rik UTSW 14 24293380 intron probably benign
R6550:E330034G19Rik UTSW 14 24296818 missense probably benign 0.12
R6799:E330034G19Rik UTSW 14 24296110 missense probably benign 0.03
R6831:E330034G19Rik UTSW 14 24296095 missense probably benign 0.16
R6920:E330034G19Rik UTSW 14 24308242 missense unknown
R7457:E330034G19Rik UTSW 14 24309514 missense unknown
R8097:E330034G19Rik UTSW 14 24306852 missense unknown
R8210:E330034G19Rik UTSW 14 24296036 missense
R8221:E330034G19Rik UTSW 14 24296067 splice site probably null
R8243:E330034G19Rik UTSW 14 24308292 missense
R8830:E330034G19Rik UTSW 14 24309508 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCCTCTTGGTGATGGAGAC -3'
(R):5'- GGTAGTCCAACGGGCAAATG -3'

Sequencing Primer
(F):5'- CTTGGTGATGGAGACTTTAGAATCTC -3'
(R):5'- ATGGGGCTACGCATTACCCTAAG -3'
Posted On2015-04-29