Incidental Mutation 'R3966:CN725425'
ID312370
Institutional Source Beutler Lab
Gene Symbol CN725425
Ensembl Gene ENSMUSG00000078932
Gene NamecDNA sequence CN725425
SynonymsGm5807
MMRRC Submission 040935-MU
Accession Numbers

Ensembl: ENSMUST00000109284; MGI: 3613655

Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91199494-91260894 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 91242687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109284] [ENSMUST00000190436]
Predicted Effect probably null
Transcript: ENSMUST00000109284
SMART Domains Protein: ENSMUSP00000104907
Gene: ENSMUSG00000078932

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
Pfam:DUF4552 219 643 2.7e-202 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190436
SMART Domains Protein: ENSMUSP00000140772
Gene: ENSMUSG00000078932

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
Pfam:DUF4552 226 650 1.4e-184 PFAM
Meta Mutation Damage Score 0.9480 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Ms4a6b T C 19: 11,521,734 S71P probably benign Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in CN725425
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:CN725425 APN 15 91245752 missense possibly damaging 0.71
IGL02176:CN725425 APN 15 91245821 missense probably benign
3-1:CN725425 UTSW 15 91260521 missense possibly damaging 0.52
R0449:CN725425 UTSW 15 91238944 missense possibly damaging 0.73
R0554:CN725425 UTSW 15 91260763 missense possibly damaging 0.86
R1442:CN725425 UTSW 15 91238955 missense possibly damaging 0.96
R1670:CN725425 UTSW 15 91245815 missense possibly damaging 0.86
R1674:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R2425:CN725425 UTSW 15 91245855 missense probably damaging 0.97
R4959:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R4973:CN725425 UTSW 15 91245701 missense possibly damaging 0.92
R5506:CN725425 UTSW 15 91235826 missense possibly damaging 0.85
R5512:CN725425 UTSW 15 91240756 missense probably benign
R5726:CN725425 UTSW 15 91260503 missense possibly damaging 0.85
R5808:CN725425 UTSW 15 91245644 missense probably benign 0.32
R5820:CN725425 UTSW 15 91260697 missense possibly damaging 0.71
R5945:CN725425 UTSW 15 91245777 missense possibly damaging 0.86
R6366:CN725425 UTSW 15 91246921 missense possibly damaging 0.93
R6441:CN725425 UTSW 15 91235802 missense probably benign 0.33
R6484:CN725425 UTSW 15 91260572 missense probably benign 0.32
R6523:CN725425 UTSW 15 91231581 missense probably benign 0.01
R6721:CN725425 UTSW 15 91231618 missense possibly damaging 0.53
R6901:CN725425 UTSW 15 91240763 missense possibly damaging 0.93
R7341:CN725425 UTSW 15 91242670 missense possibly damaging 0.96
R7654:CN725425 UTSW 15 91239435 missense probably benign 0.04
R7704:CN725425 UTSW 15 91235790 missense possibly damaging 0.86
R7709:CN725425 UTSW 15 91240727 missense probably benign
R7880:CN725425 UTSW 15 91246105 nonsense probably null
R8371:CN725425 UTSW 15 91240770 missense probably benign 0.33
Z1088:CN725425 UTSW 15 91245762 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTATAGACATTGCTCACCTGG -3'
(R):5'- GAAGTCCTAGAATGCGCAGTATG -3'

Sequencing Primer
(F):5'- ACCTGGGTGCCATTCTTAGTAAAC -3'
(R):5'- CCTAGAATGCGCAGTATGTTAGTG -3'
Posted On2015-04-29