Incidental Mutation 'R3966:Ms4a6b'
ID312378
Institutional Source Beutler Lab
Gene Symbol Ms4a6b
Ensembl Gene ENSMUSG00000024677
Gene Namemembrane-spanning 4-domains, subfamily A, member 6B
Synonyms
MMRRC Submission 040935-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3966 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11516512-11531256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11521734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 71 (S71P)
Ref Sequence ENSEMBL: ENSMUSP00000124685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025580] [ENSMUST00000161157] [ENSMUST00000161283] [ENSMUST00000163078]
Predicted Effect probably benign
Transcript: ENSMUST00000025580
AA Change: S71P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025580
Gene: ENSMUSG00000024677
AA Change: S71P

DomainStartEndE-ValueType
Pfam:CD20 47 204 2.8e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159587
Predicted Effect probably benign
Transcript: ENSMUST00000161157
AA Change: S71P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125519
Gene: ENSMUSG00000024677
AA Change: S71P

DomainStartEndE-ValueType
Pfam:CD20 47 117 8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161283
AA Change: S22P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124277
Gene: ENSMUSG00000024677
AA Change: S22P

DomainStartEndE-ValueType
Pfam:CD20 1 69 9.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163078
AA Change: S71P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124685
Gene: ENSMUSG00000024677
AA Change: S71P

DomainStartEndE-ValueType
Pfam:CD20 47 204 4.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189628
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530099J19Rik A G 13: 19,729,444 noncoding transcript Het
Agap1 T C 1: 89,834,461 I371T probably damaging Het
Brwd1 G A 16: 96,044,530 T731I probably damaging Het
C1galt1c1 A T X: 38,631,576 V181E probably benign Het
C3 A G 17: 57,218,664 V864A probably damaging Het
Cadps A T 14: 12,522,161 probably null Het
Cemip T A 7: 83,951,509 Y968F probably benign Het
Ces1g C A 8: 93,328,511 R186L possibly damaging Het
Chd2 A G 7: 73,464,395 probably benign Het
Clptm1l T C 13: 73,615,972 Y404H probably damaging Het
CN725425 T A 15: 91,242,687 probably null Het
Ctc1 T A 11: 69,031,128 V800D probably damaging Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
E330034G19Rik G T 14: 24,306,871 M158I unknown Het
Ehbp1l1 C T 19: 5,710,573 probably null Het
Gm12169 T A 11: 46,535,513 V149D possibly damaging Het
Gm14137 T A 2: 119,175,016 S19T probably benign Het
Gprc6a CAAA CA 10: 51,615,680 probably null Het
Inhbb C A 1: 119,417,561 G333W probably damaging Het
Kcnb1 C T 2: 167,104,492 C812Y probably damaging Het
Kdm4c A G 4: 74,298,583 D193G probably damaging Het
Mbd5 A T 2: 49,272,070 I855L possibly damaging Het
Mcpt1 G A 14: 56,019,046 V80M probably benign Het
Med31 C T 11: 72,211,929 A118T probably benign Het
Megf10 A G 18: 57,180,574 D30G probably damaging Het
Muc2 G A 7: 141,699,664 R120H probably benign Het
Mycbp2 A G 14: 103,138,725 probably benign Het
Myrf T C 19: 10,219,615 E267G probably benign Het
Ncor1 T C 11: 62,344,757 T624A probably damaging Het
Nfat5 G T 8: 107,367,289 A721S possibly damaging Het
Nfatc2 C T 2: 168,504,549 S875N probably benign Het
Npm1 C T 11: 33,160,350 G148D probably benign Het
Nrap T C 19: 56,342,144 S1126G probably damaging Het
Nucb2 A G 7: 116,528,875 E273G probably damaging Het
Prkd1 C T 12: 50,392,941 E368K probably benign Het
Ptgs2 T A 1: 150,105,475 I503N probably damaging Het
Qrfpr A G 3: 36,181,000 S243P possibly damaging Het
Safb2 T C 17: 56,575,356 S426G probably null Het
Sos1 C T 17: 80,455,179 R73H probably damaging Het
Spink10 T C 18: 62,657,904 I87T probably damaging Het
Tet2 A G 3: 133,487,657 S339P possibly damaging Het
Tmx4 T C 2: 134,600,061 I206V possibly damaging Het
Tom1 A G 8: 75,059,239 K360E probably benign Het
Trp73 A G 4: 154,062,036 V422A probably benign Het
Vmn2r33 T C 7: 7,554,169 M511V probably benign Het
Zfp628 T C 7: 4,921,745 S989P probably benign Het
Other mutations in Ms4a6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ms4a6b APN 19 11529490 missense possibly damaging 0.72
IGL01373:Ms4a6b APN 19 11529507 missense possibly damaging 0.71
IGL03258:Ms4a6b APN 19 11521708 missense probably damaging 1.00
R0443:Ms4a6b UTSW 19 11521680 missense possibly damaging 0.95
R0616:Ms4a6b UTSW 19 11526898 critical splice donor site probably null
R1649:Ms4a6b UTSW 19 11520442 missense possibly damaging 0.94
R1826:Ms4a6b UTSW 19 11523934 missense probably damaging 1.00
R3964:Ms4a6b UTSW 19 11521734 missense probably benign 0.01
R5380:Ms4a6b UTSW 19 11521680 missense probably damaging 1.00
R5862:Ms4a6b UTSW 19 11521803 missense probably benign 0.13
R5922:Ms4a6b UTSW 19 11520379 missense possibly damaging 0.94
R6048:Ms4a6b UTSW 19 11520370 missense possibly damaging 0.62
R6120:Ms4a6b UTSW 19 11521695 missense probably benign 0.24
R6371:Ms4a6b UTSW 19 11520364 missense probably damaging 1.00
R7057:Ms4a6b UTSW 19 11526889 missense possibly damaging 0.79
R7253:Ms4a6b UTSW 19 11520396 missense probably benign 0.26
R7516:Ms4a6b UTSW 19 11529543 missense probably benign
R7543:Ms4a6b UTSW 19 11521791 missense not run
R7645:Ms4a6b UTSW 19 11523940 missense probably damaging 1.00
Z1176:Ms4a6b UTSW 19 11529486 critical splice acceptor site probably null
Z1177:Ms4a6b UTSW 19 11520423 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GCAGAGCTTGTACAGTGTCTG -3'
(R):5'- ACTAAGACCTCTGATGACAGACATG -3'

Sequencing Primer
(F):5'- ACAGTGTCTGTGTGCTCAC -3'
(R):5'- GAGAACAAGGTTTACCATTGACC -3'
Posted On2015-04-29