Mutagenetix > Incidental Mutation

Incidental Mutation 'R3967:Depdc5'

312387

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

040838-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3967 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 32944115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 322 (C322*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]

AlphaFold

P61460

Predicted Effect

probably null
Transcript: ENSMUST00000049780
AA Change: C916*

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: C916*

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000087897
AA Change: C925*

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: C925*

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119705
AA Change: C916*

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: C916*

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120902
AA Change: C916*

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: C916*

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000124780
AA Change: C278*

SMART Domains

Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: C278*

Domain	Start	End	E-Value	Type
low complexity region	179	189	N/A	INTRINSIC
low complexity region	347	359	N/A	INTRINSIC
SCOP:d1fsha_	519	586	1e-13	SMART
Blast:DEP	537	589	2e-24	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000130461
AA Change: C1*

SMART Domains

Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426
AA Change: C1*

Domain	Start	End	E-Value	Type
low complexity region	70	82	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000137169
AA Change: C322*

SMART Domains

Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: C322*

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC
low complexity region	224	234	N/A	INTRINSIC
low complexity region	392	404	N/A	INTRINSIC
low complexity region	535	551	N/A	INTRINSIC
DEP	560	635	2.49e-15	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	896	910	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201802

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.2%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700018B08Rik	G	T	8: 121,539,980	Q56K	possibly damaging	Het
Adam18	C	A	8: 24,629,710	V518L	probably benign	Het
Akap6	A	T	12: 53,141,453	K1883N	probably damaging	Het
Arhgef12	C	A	9: 43,005,551	R432L	probably damaging	Het
Armcx6	G	T	X: 134,749,756	H109N	possibly damaging	Het
Ctnnd2	C	A	15: 30,646,929	A257E	possibly damaging	Het
Enpp7	T	C	11: 118,991,001	I324T	probably damaging	Het
Gm14401	T	C	2: 177,086,996	Y292H	possibly damaging	Het
Gm6871	A	T	7: 41,546,724	H196Q	probably damaging	Het
Gm9964	T	C	11: 79,296,376	T82A	unknown	Het
Gria2	T	A	3: 80,710,777	Q317L	possibly damaging	Het
Grtp1	G	A	8: 13,189,705	T134I	probably benign	Het
Itpkb	A	T	1: 180,327,798		probably benign	Het
Kbtbd12	A	G	6: 88,618,506	V114A	probably benign	Het
Lama3	A	T	18: 12,580,341	K3230M	probably damaging	Het
Ly75	T	C	2: 60,327,873	I1023V	possibly damaging	Het
Myof	C	T	19: 37,901,263	V1287M	probably damaging	Het
Myof	T	G	19: 38,022,610	D60A	possibly damaging	Het
Narf	A	T	11: 121,238,421	E10D	possibly damaging	Het
Nlrx1	A	T	9: 44,255,425		probably benign	Het
Olfr512	A	G	7: 108,713,853	M155V	probably benign	Het
Olfr921	A	G	9: 38,775,368	T38A	probably benign	Het
Pabpc5	A	G	X: 119,928,624	E212G	probably benign	Het
Pidd1	A	G	7: 141,439,082	F829L	possibly damaging	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Pkn2	A	G	3: 142,809,677	C658R	probably damaging	Het
Psd	C	T	19: 46,324,406	R175H	probably benign	Het
Rab39	G	A	9: 53,686,632	A111V	possibly damaging	Het
Rb1cc1	T	A	1: 6,248,270		probably benign	Het
Rnf39	C	A	17: 36,943,143	T19K	probably damaging	Het
Slc16a3	C	T	11: 120,955,425	T60M	possibly damaging	Het
Slc26a4	G	T	12: 31,528,687	H656N	probably damaging	Het
Slc27a1	A	G	8: 71,579,787	E184G	probably damaging	Het
Smc6	T	C	12: 11,298,326	V742A	probably benign	Het
Thoc1	T	A	18: 9,968,787	V186D	probably damaging	Het
Uhrf2	T	C	19: 30,079,915	V491A	probably damaging	Het
Uri1	A	G	7: 37,965,502	V253A	possibly damaging	Het
Vmn2r83	T	A	10: 79,491,320	N587K	probably benign	Het
Vmn2r88	A	T	14: 51,413,190	Y120F	probably benign	Het
Wwox	G	A	8: 114,488,933	A149T	probably damaging	Het
Zfp536	T	C	7: 37,473,830	*282W	probably null	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
alligator	UTSW	5	32964507	splice site	probably null
lagarto	UTSW	5	32979508	missense	probably damaging	1.00
sauros	UTSW	5	32986966	missense	possibly damaging	0.92
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8108:Depdc5	UTSW	5	32945049	missense	probably benign	0.01
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
R9157:Depdc5	UTSW	5	32945108	missense	probably damaging	0.98
R9364:Depdc5	UTSW	5	32964732	missense	probably benign
R9441:Depdc5	UTSW	5	32937698	missense	probably benign	0.03
R9450:Depdc5	UTSW	5	32934010	missense	probably benign
R9459:Depdc5	UTSW	5	32990773	missense	probably damaging	0.99
R9554:Depdc5	UTSW	5	32964732	missense	probably benign
R9569:Depdc5	UTSW	5	32867977	missense	probably damaging	0.98
R9647:Depdc5	UTSW	5	32924223	missense	possibly damaging	0.94
R9688:Depdc5	UTSW	5	32897932	nonsense	probably null
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GTTGCTTTTAAGTATCCAGGCATAC -3'
(R):5'- TGCACCAAAGGGCACAATGG -3'

Sequencing Primer
(F):5'- GGCATACCTTTGTTTTTCAGGTAC -3'
(R):5'- GTCAATGGCTGAGTAGATTTACACTG -3'

Posted On

2015-04-29