Incidental Mutation 'R3968:Ssb'
ID312425
Institutional Source Beutler Lab
Gene Symbol Ssb
Ensembl Gene ENSMUSG00000068882
Gene NameSjogren syndrome antigen B
SynonymsSS-B, autoantigen La, La protein
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69861562-69871846 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 69867449 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000090852] [ENSMUST00000112260] [ENSMUST00000132186] [ENSMUST00000142127] [ENSMUST00000166411]
Predicted Effect probably benign
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090852
SMART Domains Protein: ENSMUSP00000088365
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 2.2e-32 PFAM
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112260
SMART Domains Protein: ENSMUSP00000107879
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132186
SMART Domains Protein: ENSMUSP00000119773
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
Pfam:RRM_1 113 154 2.6e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132603
SMART Domains Protein: ENSMUSP00000115666
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
Pfam:RRM_3 46 149 2.5e-33 PFAM
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135459
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156057
Predicted Effect probably benign
Transcript: ENSMUST00000166411
SMART Domains Protein: ENSMUSP00000130313
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 1.9e-35 PFAM
low complexity region 375 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos, possible before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Ssb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ssb APN 2 69866262 missense probably benign 0.06
IGL00940:Ssb APN 2 69870835 critical splice donor site probably null
IGL00941:Ssb APN 2 69870835 critical splice donor site probably null
IGL01834:Ssb APN 2 69870803 missense possibly damaging 0.89
R0713:Ssb UTSW 2 69867359 missense probably benign 0.06
R0716:Ssb UTSW 2 69867359 missense probably benign 0.06
R0751:Ssb UTSW 2 69870565 missense probably benign
R1139:Ssb UTSW 2 69866576 missense possibly damaging 0.66
R1928:Ssb UTSW 2 69867557 splice site probably null
R2037:Ssb UTSW 2 69868819 missense probably benign 0.16
R4674:Ssb UTSW 2 69868850 missense probably benign 0.01
R5039:Ssb UTSW 2 69866237 missense possibly damaging 0.79
R5551:Ssb UTSW 2 69871130 missense probably damaging 0.99
R6102:Ssb UTSW 2 69871208 makesense probably null
R7126:Ssb UTSW 2 69866501 missense possibly damaging 0.70
R7448:Ssb UTSW 2 69863280 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTATTCTGGGGAGAGTTTACCC -3'
(R):5'- AGGTGCTGTTGTTTACCTTACC -3'

Sequencing Primer
(F):5'- TTACAGAAAGGTTTCCCAACTGACG -3'
(R):5'- GTGCTGTTGTTTACCTTACCCTATTG -3'
Posted On2015-04-29