Incidental Mutation 'R3968:Tmc2'
ID312428
Institutional Source Beutler Lab
Gene Symbol Tmc2
Ensembl Gene ENSMUSG00000060332
Gene Nametransmembrane channel-like gene family 2
Synonyms
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130195194-130264445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 130202071 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 75 (V75G)
Ref Sequence ENSEMBL: ENSMUSP00000125843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077988] [ENSMUST00000166774]
Predicted Effect probably benign
Transcript: ENSMUST00000077988
AA Change: V75G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000077139
Gene: ENSMUSG00000060332
AA Change: V75G

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 8.6e-41 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166774
AA Change: V75G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125843
Gene: ENSMUSG00000060332
AA Change: V75G

DomainStartEndE-ValueType
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
transmembrane domain 488 507 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:TMC 556 671 1.2e-36 PFAM
transmembrane domain 676 698 N/A INTRINSIC
transmembrane domain 735 757 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is necesssary for mechanotransduction in cochlear hair cells of the inner ear. Mutations in this gene may underlie hereditary disorders of balance and hearing. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele display normal hearing and motor behavior. Cochlear hair cells show partial resistance to gentamicin induced toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Tmc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tmc2 APN 2 130261304 missense possibly damaging 0.94
IGL00966:Tmc2 APN 2 130264012 missense probably benign 0.02
IGL01094:Tmc2 APN 2 130260166 splice site probably benign
IGL01331:Tmc2 APN 2 130232356 missense probably damaging 1.00
IGL01660:Tmc2 APN 2 130260224 nonsense probably null
IGL01926:Tmc2 APN 2 130260240 missense possibly damaging 0.68
IGL02150:Tmc2 APN 2 130240153 missense probably damaging 0.98
IGL02273:Tmc2 APN 2 130229206 missense probably damaging 0.99
IGL03137:Tmc2 APN 2 130240130 missense probably damaging 1.00
IGL03179:Tmc2 APN 2 130229187 missense probably damaging 1.00
FR4449:Tmc2 UTSW 2 130240196 missense probably damaging 1.00
H8786:Tmc2 UTSW 2 130226262 missense probably damaging 1.00
PIT4418001:Tmc2 UTSW 2 130248651 missense probably damaging 0.96
R0364:Tmc2 UTSW 2 130202103 missense probably benign 0.00
R1183:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R1446:Tmc2 UTSW 2 130248730 missense probably damaging 0.97
R1458:Tmc2 UTSW 2 130248762 missense probably damaging 1.00
R1589:Tmc2 UTSW 2 130247960 missense probably damaging 0.99
R1656:Tmc2 UTSW 2 130247934 missense possibly damaging 0.93
R1686:Tmc2 UTSW 2 130256116 missense possibly damaging 0.71
R1765:Tmc2 UTSW 2 130260225 missense probably benign 0.34
R1776:Tmc2 UTSW 2 130234869 missense probably damaging 1.00
R1873:Tmc2 UTSW 2 130248756 missense possibly damaging 0.68
R1972:Tmc2 UTSW 2 130214664 splice site probably benign
R2020:Tmc2 UTSW 2 130232385 missense probably damaging 1.00
R2208:Tmc2 UTSW 2 130214563 splice site probably null
R4732:Tmc2 UTSW 2 130261397 splice site probably null
R4733:Tmc2 UTSW 2 130261397 splice site probably null
R4989:Tmc2 UTSW 2 130202041 missense possibly damaging 0.88
R5143:Tmc2 UTSW 2 130234818 missense probably damaging 0.98
R5411:Tmc2 UTSW 2 130240115 missense probably damaging 1.00
R5514:Tmc2 UTSW 2 130241644 missense possibly damaging 0.94
R5690:Tmc2 UTSW 2 130232386 missense probably damaging 1.00
R5983:Tmc2 UTSW 2 130247976 missense probably damaging 1.00
R6451:Tmc2 UTSW 2 130264203 missense probably damaging 0.99
R6927:Tmc2 UTSW 2 130261380 missense probably benign
R7132:Tmc2 UTSW 2 130232409 missense possibly damaging 0.82
R7240:Tmc2 UTSW 2 130234804 missense possibly damaging 0.80
R7353:Tmc2 UTSW 2 130196577 critical splice donor site probably null
X0019:Tmc2 UTSW 2 130208285 missense possibly damaging 0.59
X0052:Tmc2 UTSW 2 130201972 missense probably benign 0.00
Z1177:Tmc2 UTSW 2 130208296 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GCTCTTGCAGGTGACAAGTC -3'
(R):5'- CCTGTGATGGTCTGGGAAAG -3'

Sequencing Primer
(F):5'- TGACAAGTCAGCAAGGAGACCC -3'
(R):5'- GAGTGGTAACTACTTCTCTCCCAAAG -3'
Posted On2015-04-29