Incidental Mutation 'R3968:Yap1'
ID312441
Institutional Source Beutler Lab
Gene Symbol Yap1
Ensembl Gene ENSMUSG00000053110
Gene Nameyes-associated protein 1
SynonymsYki, Yap, yorkie
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7931999-8004596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7973876 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 188 (R188Q)
Ref Sequence ENSEMBL: ENSMUSP00000133959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065353] [ENSMUST00000086580] [ENSMUST00000173085] [ENSMUST00000173264] [ENSMUST00000174577]
Predicted Effect probably damaging
Transcript: ENSMUST00000065353
AA Change: R188Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069554
Gene: ENSMUSG00000053110
AA Change: R188Q

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 4e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086580
AA Change: R188Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083772
Gene: ENSMUSG00000053110
AA Change: R188Q

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172870
Predicted Effect probably damaging
Transcript: ENSMUST00000173085
AA Change: R188Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134007
Gene: ENSMUSG00000053110
AA Change: R188Q

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173227
Predicted Effect probably damaging
Transcript: ENSMUST00000173264
AA Change: R188Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134237
Gene: ENSMUSG00000053110
AA Change: R188Q

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174577
AA Change: R188Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133959
Gene: ENSMUSG00000053110
AA Change: R188Q

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174604
AA Change: R94Q
SMART Domains Protein: ENSMUSP00000134250
Gene: ENSMUSG00000053110
AA Change: R94Q

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
WW 64 96 5.63e-12 SMART
WW 123 155 8.66e-13 SMART
coiled coil region 191 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174760
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Embryos homozygous for a null mutation of this gene die between embryonic days E9.5 and E10.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion. Heterozygous mice are viable, appear normal and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Other mutations in Yap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Yap1 APN 9 7934741 splice site probably benign
IGL01404:Yap1 APN 9 7934741 splice site probably benign
IGL02338:Yap1 APN 9 7962281 critical splice donor site probably null
IGL02398:Yap1 APN 9 7950535 missense probably benign 0.06
IGL02793:Yap1 APN 9 7973906 missense probably benign 0.44
Puddel_hunde UTSW 9 8004284 missense probably damaging 1.00
R0410:Yap1 UTSW 9 8001467 missense probably damaging 1.00
R1507:Yap1 UTSW 9 7953140 splice site probably benign
R1837:Yap1 UTSW 9 7962349 missense probably damaging 1.00
R3978:Yap1 UTSW 9 8004284 missense probably damaging 1.00
R4111:Yap1 UTSW 9 7938431 makesense probably null
R4113:Yap1 UTSW 9 7938431 makesense probably null
R4573:Yap1 UTSW 9 7934681 missense probably damaging 1.00
R5028:Yap1 UTSW 9 8001689 missense probably benign 0.05
R6397:Yap1 UTSW 9 8001466 missense probably damaging 1.00
R6407:Yap1 UTSW 9 7962372 missense possibly damaging 0.46
R7743:Yap1 UTSW 9 7962378 missense probably benign 0.04
X0020:Yap1 UTSW 9 7938435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAGTCTCCTCAATGGATTAAGAC -3'
(R):5'- CAGTGGTAAAGCACTCAGACATC -3'

Sequencing Primer
(F):5'- CTCCTCAATGGATTAAGACTAAATGC -3'
(R):5'- GTGGTAAAGCACTCAGACATCATACC -3'
Posted On2015-04-29