Incidental Mutation 'R3968:Nlrx1'
ID312444
Institutional Source Beutler Lab
Gene Symbol Nlrx1
Ensembl Gene ENSMUSG00000032109
Gene NameNLR family member X1
Synonyms
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44252717-44268599 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 44255425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034618] [ENSMUST00000034621] [ENSMUST00000168499] [ENSMUST00000169651]
Predicted Effect probably benign
Transcript: ENSMUST00000034618
SMART Domains Protein: ENSMUSP00000034618
Gene: ENSMUSG00000032105

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
PDZ 58 130 2.04e-15 SMART
PDZ 165 235 2.93e-7 SMART
PDZ 271 346 2.47e-14 SMART
PDZ 403 475 1.4e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034621
SMART Domains Protein: ENSMUSP00000034621
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.1e-22 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168499
SMART Domains Protein: ENSMUSP00000127531
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169651
SMART Domains Protein: ENSMUSP00000126555
Gene: ENSMUSG00000032109

DomainStartEndE-ValueType
Pfam:NACHT 160 325 1.3e-23 PFAM
low complexity region 543 556 N/A INTRINSIC
LRR 695 722 1.66e2 SMART
LRR 749 776 3.59e1 SMART
LRR 778 805 6.23e-2 SMART
LRR 806 833 1.13e0 SMART
LRR 834 861 1.99e1 SMART
LRR 862 885 8.11e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215389
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr722 A T 14: 49,895,526 I92N probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Nlrx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nlrx1 APN 9 44253279 missense probably damaging 0.96
IGL00233:Nlrx1 APN 9 44264068 missense probably benign 0.37
IGL02388:Nlrx1 APN 9 44264005 missense probably benign 0.09
IGL02450:Nlrx1 APN 9 44253501 missense probably benign
IGL03353:Nlrx1 APN 9 44256593 missense probably benign
R0180:Nlrx1 UTSW 9 44255459 missense possibly damaging 0.95
R0416:Nlrx1 UTSW 9 44262914 missense probably benign
R1478:Nlrx1 UTSW 9 44264077 missense probably benign 0.04
R1762:Nlrx1 UTSW 9 44263640 missense possibly damaging 0.49
R1921:Nlrx1 UTSW 9 44254134 nonsense probably null
R1972:Nlrx1 UTSW 9 44253456 missense probably benign 0.01
R2050:Nlrx1 UTSW 9 44262780 missense probably damaging 1.00
R2100:Nlrx1 UTSW 9 44262608 missense probably damaging 1.00
R3967:Nlrx1 UTSW 9 44255425 splice site probably benign
R3969:Nlrx1 UTSW 9 44255425 splice site probably benign
R4898:Nlrx1 UTSW 9 44256897 missense probably benign
R4951:Nlrx1 UTSW 9 44253429 missense possibly damaging 0.81
R4956:Nlrx1 UTSW 9 44262612 nonsense probably null
R4959:Nlrx1 UTSW 9 44254151 missense possibly damaging 0.79
R5235:Nlrx1 UTSW 9 44263750 missense probably damaging 0.99
R5536:Nlrx1 UTSW 9 44263886 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6030:Nlrx1 UTSW 9 44263760 missense probably damaging 1.00
R6698:Nlrx1 UTSW 9 44265807 missense probably damaging 1.00
R7130:Nlrx1 UTSW 9 44262341 missense possibly damaging 0.83
R7253:Nlrx1 UTSW 9 44264704 splice site probably null
R7457:Nlrx1 UTSW 9 44256510 missense probably benign 0.28
X0023:Nlrx1 UTSW 9 44256563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGGGCTGATATTATCCAGG -3'
(R):5'- AGAGGCCACTTGAGCAACAG -3'

Sequencing Primer
(F):5'- GGCTATCCTGAAACTTGCGCTATAG -3'
(R):5'- CACTTGAGCAACAGGGGGC -3'
Posted On2015-04-29