Incidental Mutation 'R3968:Olfr722'
ID312455
Institutional Source Beutler Lab
Gene Symbol Olfr722
Ensembl Gene ENSMUSG00000048933
Gene Nameolfactory receptor 722
SynonymsGA_x6K02T2PMLR-5566715-5565789, MOR241-3
MMRRC Submission 040936-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3968 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49894258-49901999 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49895526 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 92 (I92N)
Ref Sequence ENSEMBL: ENSMUSP00000059721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053290]
Predicted Effect probably damaging
Transcript: ENSMUST00000053290
AA Change: I92N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059721
Gene: ENSMUSG00000048933
AA Change: I92N

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 4.3e-44 PFAM
Pfam:7tm_1 41 288 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213271
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Cdhr2 A T 13: 54,726,458 N781I probably damaging Het
Cela1 C T 15: 100,684,653 G93S probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cysltr2 A G 14: 73,030,174 I32T probably damaging Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Fcho2 A T 13: 98,735,056 S551T probably benign Het
Fzd8 T C 18: 9,214,070 V384A probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
H2-M2 C T 17: 37,481,306 G318S possibly damaging Het
Il21r G T 7: 125,628,043 probably null Het
Itgam T C 7: 128,113,033 Y697H probably damaging Het
Itpkb A T 1: 180,327,798 probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Net1 A G 13: 3,907,795 probably null Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Oard1 T C 17: 48,415,254 Y93H probably damaging Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pcm1 T C 8: 41,325,830 L1825P probably damaging Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Ppfia2 T A 10: 106,906,521 D1058E probably damaging Het
Ppl T C 16: 5,100,332 probably null Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Sema3g T C 14: 31,226,521 probably null Het
Slc19a1 T C 10: 77,041,846 Y72H probably damaging Het
Sntb2 T A 8: 106,997,140 Y340* probably null Het
Srrm4 A G 5: 116,444,744 probably benign Het
Ssb C T 2: 69,867,449 probably benign Het
Sval2 T A 6: 41,861,927 V14E probably damaging Het
Tmc2 T G 2: 130,202,071 V75G probably benign Het
Tnnc2 T C 2: 164,777,537 E129G possibly damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Yap1 C T 9: 7,973,876 R188Q probably damaging Het
Other mutations in Olfr722
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1229:Olfr722 UTSW 14 49895254 nonsense probably null
R1400:Olfr722 UTSW 14 49895691 missense possibly damaging 0.49
R1417:Olfr722 UTSW 14 49895563 nonsense probably null
R2126:Olfr722 UTSW 14 49895067 missense probably benign 0.01
R4008:Olfr722 UTSW 14 49895007 missense probably benign 0.00
R4032:Olfr722 UTSW 14 49894976 missense probably benign 0.22
R4409:Olfr722 UTSW 14 49895773 missense probably benign 0.01
R4934:Olfr722 UTSW 14 49895749 missense probably benign 0.00
R5110:Olfr722 UTSW 14 49895575 missense possibly damaging 0.49
R5232:Olfr722 UTSW 14 49895698 missense probably damaging 1.00
R7019:Olfr722 UTSW 14 49895667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACAATGGAATGAGCAAAACCC -3'
(R):5'- AACTCCTGGTCTTCGCACTG -3'

Sequencing Primer
(F):5'- TGGAATGAGCAAAACCCCCAAG -3'
(R):5'- ACTCCTGGTCTTCGCACTGATTTC -3'
Posted On2015-04-29