Incidental Mutation 'R4001:Tmprss3'
ID312492
Institutional Source Beutler Lab
Gene Symbol Tmprss3
Ensembl Gene ENSMUSG00000024034
Gene Nametransmembrane protease, serine 3
Synonyms
MMRRC Submission 040844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4001 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31179272-31198975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31186559 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 353 (N353S)
Ref Sequence ENSEMBL: ENSMUSP00000110196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024833] [ENSMUST00000114549]
Predicted Effect probably benign
Transcript: ENSMUST00000024833
AA Change: N331S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024833
Gene: ENSMUSG00000024034
AA Change: N331S

DomainStartEndE-ValueType
transmembrane domain 49 71 N/A INTRINSIC
LDLa 72 109 1.76e-5 SMART
SR 108 205 3.99e-4 SMART
Tryp_SPc 216 443 5.22e-96 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114549
AA Change: N353S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110196
Gene: ENSMUSG00000024034
AA Change: N353S

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
LDLa 94 131 1.76e-5 SMART
SR 130 227 3.99e-4 SMART
Tryp_SPc 238 465 5.22e-96 SMART
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (28/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a serine protease domain, a transmembrane domain, an LDL receptor-like domain, and a scavenger receptor cysteine-rich domain. Serine proteases are known to be involved in a variety of biological processes, whose malfunction often leads to human diseases and disorders. This gene was identified by its association with both congenital and childhood onset autosomal recessive deafness. This gene is expressed in fetal cochlea and many other tissues, and is thought to be involved in the development and maintenance of the inner ear or the contents of the perilymph and endolymph. This gene was also identified as a tumor-associated gene that is overexpressed in ovarian tumors. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit early onset deafness and disrupted vestibular function associated with hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415L06Rik T C X: 89,930,510 I694V probably benign Het
Aars C A 8: 111,041,602 H202N probably damaging Het
Aipl1 T A 11: 72,031,602 T94S probably damaging Het
Cdhr2 A T 13: 54,718,266 E293V probably benign Het
Chd9 C T 8: 90,956,557 R542C probably damaging Het
Clip4 A T 17: 71,799,076 I85L probably damaging Het
Cntnap5c G A 17: 58,407,740 probably null Het
Fbn1 A G 2: 125,477,495 probably null Het
Hivep2 A G 10: 14,127,732 R25G probably damaging Het
Klhdc7b A G 15: 89,387,984 N1023S probably damaging Het
Lipi T A 16: 75,573,871 R153* probably null Het
Lpcat4 A T 2: 112,239,951 Q3L probably benign Het
Naa16 C A 14: 79,343,121 probably null Het
Nalcn G T 14: 123,596,594 N56K probably damaging Het
Obscn C G 11: 59,134,569 A412P probably damaging Het
Olfr382 A G 11: 73,516,986 L71P probably damaging Het
Pde8a T A 7: 81,317,356 L415Q probably damaging Het
Rbms2 C T 10: 128,151,300 S13N probably benign Het
Rgsl1 A G 1: 153,817,584 L617P probably damaging Het
Sap18b T C 8: 95,825,440 V26A probably benign Het
Senp2 T C 16: 22,028,568 L282P possibly damaging Het
Srcap T C 7: 127,532,167 M826T probably damaging Het
Tmc3 T C 7: 83,620,063 S820P probably benign Het
Tro G A X: 150,655,202 T153I probably benign Het
Trp53bp1 A G 2: 121,205,085 S1562P probably damaging Het
Uaca G A 9: 60,871,084 V916I probably benign Het
Other mutations in Tmprss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Tmprss3 APN 17 31195008 missense probably damaging 0.97
IGL01836:Tmprss3 APN 17 31191044 missense probably benign
IGL02525:Tmprss3 APN 17 31194891 splice site probably benign
IGL02672:Tmprss3 APN 17 31191007 missense probably damaging 1.00
IGL02900:Tmprss3 APN 17 31184579 missense probably damaging 1.00
R0122:Tmprss3 UTSW 17 31193902 splice site probably benign
R0617:Tmprss3 UTSW 17 31193912 missense probably damaging 1.00
R5587:Tmprss3 UTSW 17 31193992 missense probably benign 0.00
R6077:Tmprss3 UTSW 17 31189167 missense possibly damaging 0.94
R6271:Tmprss3 UTSW 17 31186562 missense probably damaging 1.00
R6329:Tmprss3 UTSW 17 31183859 nonsense probably null
R6918:Tmprss3 UTSW 17 31188357 missense probably benign 0.19
R8279:Tmprss3 UTSW 17 31197735 missense probably benign 0.20
R8372:Tmprss3 UTSW 17 31184697 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGTGACCCACGGCTATTC -3'
(R):5'- GGACTCCTGCCACAGTTTAG -3'

Sequencing Primer
(F):5'- GTTGTGAACAGTTGGCCT -3'
(R):5'- CCACAGTTTAGGGCTACATCTGG -3'
Posted On2015-04-29