Incidental Mutation 'R4001:4930415L06Rik'
ID312496
Institutional Source Beutler Lab
Gene Symbol 4930415L06Rik
Ensembl Gene ENSMUSG00000035387
Gene NameRIKEN cDNA 4930415L06 gene
Synonyms
MMRRC Submission 040844-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4001 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location89930098-89932852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89930510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 694 (I694V)
Ref Sequence ENSEMBL: ENSMUSP00000085471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088146]
Predicted Effect probably benign
Transcript: ENSMUST00000088146
AA Change: I694V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085471
Gene: ENSMUSG00000035387
AA Change: I694V

DomainStartEndE-ValueType
SCOP:d1k5db_ 18 107 1e-22 SMART
Pfam:SMK-1 178 369 9e-72 PFAM
low complexity region 650 663 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
low complexity region 793 806 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency 100% (28/28)
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars C A 8: 111,041,602 H202N probably damaging Het
Aipl1 T A 11: 72,031,602 T94S probably damaging Het
Cdhr2 A T 13: 54,718,266 E293V probably benign Het
Chd9 C T 8: 90,956,557 R542C probably damaging Het
Clip4 A T 17: 71,799,076 I85L probably damaging Het
Cntnap5c G A 17: 58,407,740 probably null Het
Fbn1 A G 2: 125,477,495 probably null Het
Hivep2 A G 10: 14,127,732 R25G probably damaging Het
Klhdc7b A G 15: 89,387,984 N1023S probably damaging Het
Lipi T A 16: 75,573,871 R153* probably null Het
Lpcat4 A T 2: 112,239,951 Q3L probably benign Het
Naa16 C A 14: 79,343,121 probably null Het
Nalcn G T 14: 123,596,594 N56K probably damaging Het
Obscn C G 11: 59,134,569 A412P probably damaging Het
Olfr382 A G 11: 73,516,986 L71P probably damaging Het
Pde8a T A 7: 81,317,356 L415Q probably damaging Het
Rbms2 C T 10: 128,151,300 S13N probably benign Het
Rgsl1 A G 1: 153,817,584 L617P probably damaging Het
Sap18b T C 8: 95,825,440 V26A probably benign Het
Senp2 T C 16: 22,028,568 L282P possibly damaging Het
Srcap T C 7: 127,532,167 M826T probably damaging Het
Tmc3 T C 7: 83,620,063 S820P probably benign Het
Tmprss3 T C 17: 31,186,559 N353S probably damaging Het
Tro G A X: 150,655,202 T153I probably benign Het
Trp53bp1 A G 2: 121,205,085 S1562P probably damaging Het
Uaca G A 9: 60,871,084 V916I probably benign Het
Other mutations in 4930415L06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02024:4930415L06Rik APN X 89931523 missense probably benign 0.17
IGL02226:4930415L06Rik APN X 89931912 missense probably damaging 0.99
R1980:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1981:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R1982:4930415L06Rik UTSW X 89931445 missense probably damaging 1.00
R2299:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2381:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R2895:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R2896:4930415L06Rik UTSW X 89932399 missense possibly damaging 0.72
R4003:4930415L06Rik UTSW X 89930510 missense probably benign 0.34
R4042:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4043:4930415L06Rik UTSW X 89932303 missense probably damaging 1.00
R4280:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4281:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
R4282:4930415L06Rik UTSW X 89932499 missense probably damaging 1.00
Z1088:4930415L06Rik UTSW X 89930236 missense unknown
Z1088:4930415L06Rik UTSW X 89930237 missense unknown
Z1176:4930415L06Rik UTSW X 89930241 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGCAGAAGCATCCCCATGAG -3'
(R):5'- ACGTCTCTGATTGTAAACATTGTGG -3'

Sequencing Primer
(F):5'- GATGGACAACATTCAGAAGCTTC -3'
(R):5'- GGGCTTTTAAATCAATTGAGTATGTC -3'
Posted On2015-04-29