Incidental Mutation 'R3974:Plcl1'
ID312499
Institutional Source Beutler Lab
Gene Symbol Plcl1
Ensembl Gene ENSMUSG00000038349
Gene Namephospholipase C-like 1
SynonymsPRIP-1, C230017K02Rik, PLC-L
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location55405921-55754285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55698215 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 905 (M905K)
Ref Sequence ENSEMBL: ENSMUSP00000037854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042986]
Predicted Effect probably benign
Transcript: ENSMUST00000042986
AA Change: M905K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: M905K

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
PH 115 226 6.98e-4 SMART
low complexity region 301 310 N/A INTRINSIC
Pfam:EF-hand_like 316 398 5.9e-27 PFAM
PLCXc 399 543 2.13e-82 SMART
low complexity region 550 564 N/A INTRINSIC
PLCYc 586 702 2.15e-69 SMART
C2 723 829 1.02e-21 SMART
low complexity region 1080 1092 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187059
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Plcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Plcl1 APN 1 55406536 missense probably benign
IGL00491:Plcl1 APN 1 55713498 critical splice donor site probably null
IGL00753:Plcl1 APN 1 55696738 missense probably damaging 1.00
IGL01415:Plcl1 APN 1 55696396 missense possibly damaging 0.92
IGL03024:Plcl1 APN 1 55695787 missense probably damaging 1.00
K3955:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
PIT4791001:Plcl1 UTSW 1 55701931 missense probably benign 0.03
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0066:Plcl1 UTSW 1 55713475 missense probably damaging 0.99
R0083:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R0086:Plcl1 UTSW 1 55715583 missense probably damaging 1.00
R0092:Plcl1 UTSW 1 55696765 missense probably damaging 0.98
R0108:Plcl1 UTSW 1 55697939 missense possibly damaging 0.78
R1716:Plcl1 UTSW 1 55695838 missense probably damaging 0.99
R2061:Plcl1 UTSW 1 55751345 missense probably benign 0.01
R2128:Plcl1 UTSW 1 55697838 missense probably damaging 1.00
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2869:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2870:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2872:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R2873:Plcl1 UTSW 1 55697150 missense probably benign 0.09
R3819:Plcl1 UTSW 1 55696599 missense probably benign
R3975:Plcl1 UTSW 1 55698215 missense probably benign 0.30
R4214:Plcl1 UTSW 1 55751335 nonsense probably null
R4400:Plcl1 UTSW 1 55715577 missense probably damaging 1.00
R4452:Plcl1 UTSW 1 55696886 missense probably benign 0.00
R4615:Plcl1 UTSW 1 55698134 missense probably benign 0.00
R5060:Plcl1 UTSW 1 55696512 missense possibly damaging 0.84
R5422:Plcl1 UTSW 1 55697384 missense probably benign 0.00
R5568:Plcl1 UTSW 1 55696150 missense possibly damaging 0.82
R5781:Plcl1 UTSW 1 55695989 missense possibly damaging 0.92
R5809:Plcl1 UTSW 1 55696001 missense probably damaging 1.00
R6009:Plcl1 UTSW 1 55696246 missense probably damaging 1.00
R6339:Plcl1 UTSW 1 55696315 missense probably damaging 1.00
R6431:Plcl1 UTSW 1 55697252 missense probably benign 0.03
R6534:Plcl1 UTSW 1 55696748 missense probably damaging 1.00
R6565:Plcl1 UTSW 1 55697958 nonsense probably null
R6678:Plcl1 UTSW 1 55695776 missense probably benign 0.13
R6773:Plcl1 UTSW 1 55751302 missense probably benign 0.03
R6925:Plcl1 UTSW 1 55406598 nonsense probably null
R7168:Plcl1 UTSW 1 55697463 missense probably damaging 1.00
R7256:Plcl1 UTSW 1 55698218 missense probably benign 0.45
R7522:Plcl1 UTSW 1 55696364 missense probably benign 0.31
R7527:Plcl1 UTSW 1 55697114 missense probably damaging 1.00
R7536:Plcl1 UTSW 1 55713481 nonsense probably null
R7585:Plcl1 UTSW 1 55406449 missense probably benign 0.00
R7591:Plcl1 UTSW 1 55697449 missense probably benign 0.01
R7689:Plcl1 UTSW 1 55697468 missense probably damaging 1.00
R7960:Plcl1 UTSW 1 55697284 missense possibly damaging 0.48
R8029:Plcl1 UTSW 1 55696078 missense probably benign 0.26
R8241:Plcl1 UTSW 1 55695817 missense probably benign 0.01
R8323:Plcl1 UTSW 1 55697736 missense possibly damaging 0.58
Z1176:Plcl1 UTSW 1 55696040 missense probably benign 0.20
Z1176:Plcl1 UTSW 1 55751284 nonsense probably null
Z1177:Plcl1 UTSW 1 55696884 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ATGGAGCACGTGACCCTTTTC -3'
(R):5'- TGGCCAAACTCAACCTTGTACTC -3'

Sequencing Primer
(F):5'- ACCCTTTTCGTTCACATAGCAATAAC -3'
(R):5'- AACTCAACCTTGTACTCACAATTAG -3'
Posted On2015-04-30