Incidental Mutation 'R3974:Cnbd1'
ID312515
Institutional Source Beutler Lab
Gene Symbol Cnbd1
Ensembl Gene ENSMUSG00000073991
Gene Namecyclic nucleotide binding domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location18860454-19122526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18887693 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 274 (R274C)
Ref Sequence ENSEMBL: ENSMUSP00000121576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137780]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133363
Predicted Effect probably benign
Transcript: ENSMUST00000137780
AA Change: R274C

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000121576
Gene: ENSMUSG00000073991
AA Change: R274C

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Blast:cNMP 166 225 6e-6 BLAST
SCOP:d1cx4a1 296 430 3e-13 SMART
Blast:cNMP 318 429 2e-60 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Cnbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Cnbd1 APN 4 18906988 splice site probably benign
IGL01101:Cnbd1 APN 4 18907098 missense probably benign 0.30
IGL01365:Cnbd1 APN 4 18860576 missense probably damaging 1.00
IGL01646:Cnbd1 APN 4 18895141 nonsense probably null
IGL02106:Cnbd1 APN 4 18894993 missense possibly damaging 0.55
IGL02218:Cnbd1 APN 4 18887739 missense probably benign 0.00
IGL02335:Cnbd1 APN 4 19055095 missense possibly damaging 0.87
IGL02380:Cnbd1 APN 4 18887748 critical splice acceptor site probably null
IGL02380:Cnbd1 APN 4 18887749 critical splice acceptor site probably null
IGL02404:Cnbd1 APN 4 18895047 missense possibly damaging 0.64
IGL03293:Cnbd1 APN 4 18860565 missense possibly damaging 0.65
IGL03301:Cnbd1 APN 4 19055039 missense probably benign 0.00
IGL03342:Cnbd1 APN 4 19098264 splice site probably benign
IGL03392:Cnbd1 APN 4 18862111 missense probably damaging 1.00
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0195:Cnbd1 UTSW 4 18906988 splice site probably benign
R0462:Cnbd1 UTSW 4 18895044 missense probably benign 0.01
R0909:Cnbd1 UTSW 4 19122444 missense probably benign
R1435:Cnbd1 UTSW 4 18907026 missense probably benign 0.00
R1995:Cnbd1 UTSW 4 19055112 missense possibly damaging 0.55
R2495:Cnbd1 UTSW 4 18860579 missense probably damaging 1.00
R4083:Cnbd1 UTSW 4 18886042 missense possibly damaging 0.88
R4494:Cnbd1 UTSW 4 19098150 missense probably benign 0.34
R4558:Cnbd1 UTSW 4 19055095 missense possibly damaging 0.87
R4833:Cnbd1 UTSW 4 18862120 missense probably damaging 0.97
R5326:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5542:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5930:Cnbd1 UTSW 4 18886119 missense probably benign 0.14
R5958:Cnbd1 UTSW 4 18862056 missense probably benign 0.31
R6064:Cnbd1 UTSW 4 18895084 missense probably benign 0.14
R6250:Cnbd1 UTSW 4 19098255 missense probably benign 0.00
R6348:Cnbd1 UTSW 4 18860462 missense probably damaging 0.99
R7027:Cnbd1 UTSW 4 18862063 missense probably benign 0.01
R7905:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
R7988:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GAGACCCTGGTTTTCCTGACAAG -3'
(R):5'- GGTAGTCCTTCTTCCATGGC -3'

Sequencing Primer
(F):5'- CTGGTTTTCCTGACAAGTACTGAAAG -3'
(R):5'- TCCATGGCAGTGGAACTAGAACTC -3'
Posted On2015-04-30