Incidental Mutation 'R3974:2510039O18Rik'
ID312516
Institutional Source Beutler Lab
Gene Symbol 2510039O18Rik
Ensembl Gene ENSMUSG00000044496
Gene NameRIKEN cDNA 2510039O18 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location147940895-147947314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147945031 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 486 (I486T)
Ref Sequence ENSEMBL: ENSMUSP00000099522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103232]
Predicted Effect probably damaging
Transcript: ENSMUST00000103232
AA Change: I486T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099522
Gene: ENSMUSG00000044496
AA Change: I486T

DomainStartEndE-ValueType
Pfam:DUF2152 6 629 2.9e-251 PFAM
Meta Mutation Damage Score 0.8327 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in 2510039O18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:2510039O18Rik APN 4 147945064 missense probably damaging 1.00
R1135:2510039O18Rik UTSW 4 147944658 missense probably benign 0.26
R1546:2510039O18Rik UTSW 4 147941775 missense probably damaging 0.97
R2008:2510039O18Rik UTSW 4 147941577 missense probably benign 0.31
R2437:2510039O18Rik UTSW 4 147946618 makesense probably null
R3937:2510039O18Rik UTSW 4 147942053 missense possibly damaging 0.54
R3970:2510039O18Rik UTSW 4 147945322 missense probably damaging 0.99
R3973:2510039O18Rik UTSW 4 147945031 missense probably damaging 1.00
R4050:2510039O18Rik UTSW 4 147944992 missense probably damaging 1.00
R4431:2510039O18Rik UTSW 4 147941565 missense probably benign 0.01
R4750:2510039O18Rik UTSW 4 147941488 missense probably damaging 0.99
R4943:2510039O18Rik UTSW 4 147945098 missense probably damaging 1.00
R5139:2510039O18Rik UTSW 4 147945448 missense probably damaging 0.98
R6735:2510039O18Rik UTSW 4 147941817 missense probably benign
R7139:2510039O18Rik UTSW 4 147941838 missense possibly damaging 0.90
R7689:2510039O18Rik UTSW 4 147944983 missense probably damaging 1.00
R8307:2510039O18Rik UTSW 4 147941380 missense probably benign 0.00
V5088:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
V5622:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
V5622:2510039O18Rik UTSW 4 147941776 missense probably benign 0.18
Z1088:2510039O18Rik UTSW 4 147944745 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACCTGTGGAAGTTGACCC -3'
(R):5'- GGTCGGTGGAGATGTACAAC -3'

Sequencing Primer
(F):5'- CTGTGGAAGTTGACCCTCCAGAAG -3'
(R):5'- TACAACAGTGGTGTGATGGGC -3'
Posted On2015-04-30