Incidental Mutation 'R3974:Grik2'
ID312532
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Nameglutamate receptor, ionotropic, kainate 2 (beta 2)
SynonymsGlurbeta2, Glur-6, Glur6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location49094833-49788766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49422654 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 37 (Y37N)
Ref Sequence ENSEMBL: ENSMUSP00000152029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218669] [ENSMUST00000218823]
Predicted Effect probably damaging
Transcript: ENSMUST00000079751
AA Change: Y324N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: Y324N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105484
AA Change: Y324N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: Y324N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105485
AA Change: Y324N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: Y324N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105486
AA Change: Y324N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: Y324N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 3.8e-11 PFAM
Pfam:ANF_receptor 52 395 1.5e-74 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 6e-13 BLAST
low complexity region 875 891 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105487
AA Change: Y324N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: Y324N

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000218441
AA Change: Y324N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218598
AA Change: Y324N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218669
AA Change: Y37N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000218823
AA Change: Y324N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219051
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49355928 missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49355938 missense probably damaging 1.00
IGL01012:Grik2 APN 10 49272956 missense probably damaging 1.00
IGL01302:Grik2 APN 10 49244330 missense probably damaging 0.99
IGL01657:Grik2 APN 10 49527986 critical splice donor site probably null
IGL02162:Grik2 APN 10 49422575 missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49422615 missense probably benign 0.16
IGL02512:Grik2 APN 10 49355912 missense probably benign 0.00
IGL02650:Grik2 APN 10 49101235 missense probably benign 0.03
IGL03283:Grik2 APN 10 49578269 missense probably benign 0.00
R0325:Grik2 UTSW 10 49240725 missense probably damaging 1.00
R0492:Grik2 UTSW 10 49101164 missense probably damaging 0.99
R0601:Grik2 UTSW 10 49422597 missense probably damaging 1.00
R0844:Grik2 UTSW 10 49101115 missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49527991 missense probably damaging 0.98
R1499:Grik2 UTSW 10 49132775 missense probably damaging 1.00
R1660:Grik2 UTSW 10 49244343 nonsense probably null
R1721:Grik2 UTSW 10 49523746 missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49355909 missense probably damaging 1.00
R1974:Grik2 UTSW 10 49132827 missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R3103:Grik2 UTSW 10 49240772 missense probably damaging 1.00
R4592:Grik2 UTSW 10 49422615 missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49523792 missense possibly damaging 0.71
R4748:Grik2 UTSW 10 49535341 missense possibly damaging 0.87
R4935:Grik2 UTSW 10 49240730 missense probably damaging 1.00
R4977:Grik2 UTSW 10 49132745 missense probably damaging 1.00
R5103:Grik2 UTSW 10 49496109 missense probably benign 0.33
R5330:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5331:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5736:Grik2 UTSW 10 49404410 missense probably damaging 0.96
R5740:Grik2 UTSW 10 49113477 missense probably damaging 0.99
R5747:Grik2 UTSW 10 49523774 missense probably benign
R6015:Grik2 UTSW 10 49523863 splice site probably null
R6311:Grik2 UTSW 10 49578138 missense probably damaging 0.98
R6474:Grik2 UTSW 10 49132680 missense probably benign
R6504:Grik2 UTSW 10 49356102 missense probably damaging 1.00
R6591:Grik2 UTSW 10 49272925 nonsense probably null
R6691:Grik2 UTSW 10 49272925 nonsense probably null
R6776:Grik2 UTSW 10 49355989 missense probably damaging 1.00
R7015:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R7094:Grik2 UTSW 10 49355916 missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49535367 missense probably benign 0.00
R7229:Grik2 UTSW 10 49101416 intron probably null
R7402:Grik2 UTSW 10 49535397 missense probably damaging 1.00
R7473:Grik2 UTSW 10 49113522 missense probably benign 0.22
R7514:Grik2 UTSW 10 49523808 missense probably damaging 0.99
R7526:Grik2 UTSW 10 49523822 missense possibly damaging 0.56
X0062:Grik2 UTSW 10 49272920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATTGTGTGCTAGCAGAACTG -3'
(R):5'- AATAGCAGGGTCGTACTGAGTTAG -3'

Sequencing Primer
(F):5'- AGAACTGCACTGTCCTTATTCAG -3'
(R):5'- GAAAGGTCATATGGGTCAACTGTTC -3'
Posted On2015-04-30