Incidental Mutation 'R0385:Supt16'
ID 31254
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Name suppressor of Ty 16
Synonyms Supt16h, Spt16, Fact140, Cdc68
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock # R0385 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 52160414-52197416 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 52176718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 468 (M468R)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000046709
AA Change: M468R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: M468R

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1652:Supt16 UTSW 14 52177180 missense probably benign 0.34
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
R9048:Supt16 UTSW 14 52181056 missense probably damaging 1.00
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- GGTGTGGCAATGCCAAACACAG -3'
(R):5'- AGAGGACCTTTTGGGAAGAGGCTC -3'

Sequencing Primer
(F):5'- AGATCTTCATCTCCCGAATATGTGG -3'
(R):5'- gcggcattacttactgaaagaac -3'
Posted On 2013-04-24