Incidental Mutation 'R3974:Serpina1f'
ID312546
Institutional Source Beutler Lab
Gene Symbol Serpina1f
Ensembl Gene ENSMUSG00000021081
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1F
Synonymsepserin, 0610012A11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3974 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location103688044-103695529 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 103693571 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 151 (G151*)
Ref Sequence ENSEMBL: ENSMUSP00000113736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021490] [ENSMUST00000117053] [ENSMUST00000118101]
Predicted Effect probably null
Transcript: ENSMUST00000021490
AA Change: G151*
SMART Domains Protein: ENSMUSP00000021490
Gene: ENSMUSG00000021081
AA Change: G151*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117053
AA Change: G151*
SMART Domains Protein: ENSMUSP00000112533
Gene: ENSMUSG00000021081
AA Change: G151*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 354 1.23e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118101
AA Change: G151*
SMART Domains Protein: ENSMUSP00000113736
Gene: ENSMUSG00000021081
AA Change: G151*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
SERPIN 53 409 7.69e-85 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Serpina1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Serpina1f APN 12 103691869 missense probably benign 0.02
IGL00757:Serpina1f APN 12 103693462 missense probably damaging 1.00
IGL01123:Serpina1f APN 12 103694006 missense possibly damaging 0.47
IGL01695:Serpina1f APN 12 103693684 missense probably damaging 1.00
IGL01791:Serpina1f APN 12 103693502 missense probably damaging 1.00
IGL01868:Serpina1f APN 12 103693445 missense probably benign 0.24
IGL02135:Serpina1f APN 12 103693715 missense possibly damaging 0.90
IGL03025:Serpina1f APN 12 103693546 missense probably damaging 0.99
IGL03331:Serpina1f APN 12 103690891 missense probably benign 0.04
R0084:Serpina1f UTSW 12 103693588 missense possibly damaging 0.82
R0492:Serpina1f UTSW 12 103693567 missense possibly damaging 0.72
R0893:Serpina1f UTSW 12 103693835 missense probably damaging 0.97
R2202:Serpina1f UTSW 12 103693396 missense possibly damaging 0.75
R4179:Serpina1f UTSW 12 103691920 missense probably benign 0.08
R4736:Serpina1f UTSW 12 103693546 missense probably damaging 0.97
R4948:Serpina1f UTSW 12 103689751 missense probably damaging 1.00
R5092:Serpina1f UTSW 12 103693550 missense probably damaging 1.00
R5416:Serpina1f UTSW 12 103693944 missense possibly damaging 0.68
R5887:Serpina1f UTSW 12 103689787 missense possibly damaging 0.85
R5887:Serpina1f UTSW 12 103693631 nonsense probably null
R6413:Serpina1f UTSW 12 103693694 missense probably damaging 1.00
R6566:Serpina1f UTSW 12 103693535 missense probably damaging 1.00
R7371:Serpina1f UTSW 12 103689827 missense probably damaging 0.96
R7419:Serpina1f UTSW 12 103689842 missense probably damaging 1.00
R7527:Serpina1f UTSW 12 103691908 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGATAAATCCCCTGGAGCC -3'
(R):5'- AAACACATCCTGGAGACTCTAAGG -3'

Sequencing Primer
(F):5'- ACCCTTACCATTCCAGATAATGTAG -3'
(R):5'- TCCTGGAGACTCTAAGGTTCAAC -3'
Posted On2015-04-30