Incidental Mutation 'R3974:Gdf2'
ID 312552
Institutional Source Beutler Lab
Gene Symbol Gdf2
Ensembl Gene ENSMUSG00000072625
Gene Name growth differentiation factor 2
Synonyms Bmp9
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3974 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 33941039-33947198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33944834 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 171 (V171D)
Ref Sequence ENSEMBL: ENSMUSP00000098286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100720]
AlphaFold Q9WV56
PDB Structure Pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
non-latent pro-bone morphogenetic protein 9 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000100720
AA Change: V171D

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098286
Gene: ENSMUSG00000072625
AA Change: V171D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:TGFb_propeptide 55 256 8.5e-21 PFAM
TGFB 326 428 3.83e-56 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates cartilage and bone development, angiogenesis and differentiation of cholinergic central nervous system neurons. Homozygous null mice exhibit malformations of the vasculature and skeleton. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show arteriovenous malformations, skeletal anomalies, and abnormal retinal vasculature after anti-BMP10-antibody treatment. Homozygotes for a different null allele show abnormal retinal and tracheal vasculature and tracheal lymphatic vessels after anti-BMP10 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T C 4: 147,945,031 I486T probably damaging Het
Abca8a A T 11: 110,083,502 M202K probably damaging Het
Abhd4 T A 14: 54,262,960 I117N probably damaging Het
Adam23 T A 1: 63,547,729 Y416* probably null Het
Cenpe A G 3: 135,235,225 probably null Het
Cenph A G 13: 100,763,567 V151A probably damaging Het
Cfap54 A G 10: 92,839,471 S2863P possibly damaging Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Cnbd1 G A 4: 18,887,693 R274C probably benign Het
Crot T C 5: 8,977,541 T264A probably benign Het
Dll4 A G 2: 119,334,092 D664G probably damaging Het
Ehbp1 C T 11: 22,137,867 A406T probably benign Het
Far2 T A 6: 148,150,754 I177N probably damaging Het
Flt4 T G 11: 49,636,740 V910G probably damaging Het
Fmod A G 1: 134,040,758 R179G probably benign Het
Gm884 A T 11: 103,619,101 probably benign Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Grik2 A T 10: 49,422,654 Y37N probably damaging Het
Grn T C 11: 102,436,339 V559A probably damaging Het
Muc2 T A 7: 141,746,804 probably benign Het
Myo5b T C 18: 74,634,481 Y287H probably damaging Het
Nbeal2 T C 9: 110,633,846 T1350A probably damaging Het
Nfkbiz T C 16: 55,818,436 I220M probably benign Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1049 A T 2: 86,255,591 I34N possibly damaging Het
Olfr598 T G 7: 103,329,078 D197E probably damaging Het
Omg T A 11: 79,502,398 E211D probably benign Het
Pcdhb4 A G 18: 37,308,848 T404A possibly damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Plod2 G T 9: 92,598,619 G422* probably null Het
Ppp1r12a T C 10: 108,253,480 V660A probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Ptprq T G 10: 107,712,062 K158N possibly damaging Het
Rimbp2 A G 5: 128,797,798 V243A probably damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rtn4 C T 11: 29,707,505 T553I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Serpina1f C A 12: 103,693,571 G151* probably null Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slco1a1 A T 6: 141,909,093 S611T probably benign Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Syne1 T C 10: 5,043,630 D8370G probably benign Het
Tigd4 G A 3: 84,595,278 A501T possibly damaging Het
Tjp1 A T 7: 65,297,639 C1724* probably null Het
Tmem107 G T 11: 69,071,475 probably null Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Tyw5 A T 1: 57,391,528 D165E probably damaging Het
U2af2 T A 7: 5,069,439 probably null Het
Ube3b T A 5: 114,412,430 D839E probably benign Het
Ush2a A G 1: 188,381,501 D639G probably benign Het
Veph1 A T 3: 66,158,227 M473K probably benign Het
Vmn2r72 A T 7: 85,749,809 N445K probably damaging Het
Vps37d T C 5: 135,076,539 M77V probably null Het
Other mutations in Gdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0557:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0631:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R0739:Gdf2 UTSW 14 33941221 missense probably damaging 1.00
R2142:Gdf2 UTSW 14 33945241 missense probably benign
R2292:Gdf2 UTSW 14 33945188 missense possibly damaging 0.60
R3615:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3616:Gdf2 UTSW 14 33944957 missense probably damaging 1.00
R3975:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R3976:Gdf2 UTSW 14 33944834 missense probably damaging 0.97
R4665:Gdf2 UTSW 14 33945451 missense probably damaging 1.00
R5007:Gdf2 UTSW 14 33944906 missense probably benign 0.02
R5227:Gdf2 UTSW 14 33941494 critical splice donor site probably null
R5253:Gdf2 UTSW 14 33945307 missense probably benign 0.14
R5259:Gdf2 UTSW 14 33944831 missense probably benign 0.01
R6286:Gdf2 UTSW 14 33945100 missense probably damaging 1.00
R7644:Gdf2 UTSW 14 33944890 missense probably benign 0.00
R8472:Gdf2 UTSW 14 33944840 missense probably damaging 1.00
R9067:Gdf2 UTSW 14 33941454 missense probably benign 0.20
R9525:Gdf2 UTSW 14 33945607 makesense probably null
Z1177:Gdf2 UTSW 14 33945317 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATGCTATATCGACAGCTGCC -3'
(R):5'- TTTGGAACCTGGAGGGACAC -3'

Sequencing Primer
(F):5'- TATATCGACAGCTGCCACGGAG -3'
(R):5'- ATGTCCAGTGTGTCACAGC -3'
Posted On 2015-04-30