Mutagenetix > Incidental Mutation

Incidental Mutation 'R3975:Plcl1'

312563

Institutional Source

Beutler Lab

Gene Symbol

Plcl1

Ensembl Gene

ENSMUSG00000038349

Gene Name

phospholipase C-like 1

Synonyms

PRIP-1, C230017K02Rik, PLC-L

MMRRC Submission

040939-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.910) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55405921-55754285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55698215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 905 (M905K)

Ref Sequence

ENSEMBL: ENSMUSP00000037854 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042986]

AlphaFold

Q3USB7

Predicted Effect

probably benign
Transcript: ENSMUST00000042986
AA Change: M905K

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000037854
Gene: ENSMUSG00000038349
AA Change: M905K

Domain	Start	End	E-Value	Type
low complexity region	21	41	N/A	INTRINSIC
low complexity region	49	60	N/A	INTRINSIC
PH	115	226	6.98e-4	SMART
low complexity region	301	310	N/A	INTRINSIC
Pfam:EF-hand_like	316	398	5.9e-27	PFAM
PLCXc	399	543	2.13e-82	SMART
low complexity region	550	564	N/A	INTRINSIC
PLCYc	586	702	2.15e-69	SMART
C2	723	829	1.02e-21	SMART
low complexity region	1080	1092	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187059

Meta Mutation Damage Score

0.0972

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

PHENOTYPE: Homozygous null mutants display impaired motor coordination and decreased sensitivity to the sedative diazepam. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Plcl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Plcl1	APN	1	55406536	missense	probably benign
IGL00491:Plcl1	APN	1	55713498	critical splice donor site	probably null
IGL00753:Plcl1	APN	1	55696738	missense	probably damaging	1.00
IGL01415:Plcl1	APN	1	55696396	missense	possibly damaging	0.92
IGL03024:Plcl1	APN	1	55695787	missense	probably damaging	1.00
K3955:Plcl1	UTSW	1	55697939	missense	possibly damaging	0.78
PIT4791001:Plcl1	UTSW	1	55701931	missense	probably benign	0.03
R0066:Plcl1	UTSW	1	55713475	missense	probably damaging	0.99
R0066:Plcl1	UTSW	1	55713475	missense	probably damaging	0.99
R0083:Plcl1	UTSW	1	55697939	missense	possibly damaging	0.78
R0086:Plcl1	UTSW	1	55715583	missense	probably damaging	1.00
R0092:Plcl1	UTSW	1	55696765	missense	probably damaging	0.98
R0108:Plcl1	UTSW	1	55697939	missense	possibly damaging	0.78
R1716:Plcl1	UTSW	1	55695838	missense	probably damaging	0.99
R2061:Plcl1	UTSW	1	55751345	missense	probably benign	0.01
R2128:Plcl1	UTSW	1	55697838	missense	probably damaging	1.00
R2869:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2869:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2870:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2870:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2872:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2872:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R2873:Plcl1	UTSW	1	55697150	missense	probably benign	0.09
R3819:Plcl1	UTSW	1	55696599	missense	probably benign
R3974:Plcl1	UTSW	1	55698215	missense	probably benign	0.30
R4214:Plcl1	UTSW	1	55751335	nonsense	probably null
R4400:Plcl1	UTSW	1	55715577	missense	probably damaging	1.00
R4452:Plcl1	UTSW	1	55696886	missense	probably benign	0.00
R4615:Plcl1	UTSW	1	55698134	missense	probably benign	0.00
R5060:Plcl1	UTSW	1	55696512	missense	possibly damaging	0.84
R5422:Plcl1	UTSW	1	55697384	missense	probably benign	0.00
R5568:Plcl1	UTSW	1	55696150	missense	possibly damaging	0.82
R5781:Plcl1	UTSW	1	55695989	missense	possibly damaging	0.92
R5809:Plcl1	UTSW	1	55696001	missense	probably damaging	1.00
R6009:Plcl1	UTSW	1	55696246	missense	probably damaging	1.00
R6339:Plcl1	UTSW	1	55696315	missense	probably damaging	1.00
R6431:Plcl1	UTSW	1	55697252	missense	probably benign	0.03
R6534:Plcl1	UTSW	1	55696748	missense	probably damaging	1.00
R6565:Plcl1	UTSW	1	55697958	nonsense	probably null
R6678:Plcl1	UTSW	1	55695776	missense	probably benign	0.13
R6773:Plcl1	UTSW	1	55751302	missense	probably benign	0.03
R6925:Plcl1	UTSW	1	55406598	nonsense	probably null
R7168:Plcl1	UTSW	1	55697463	missense	probably damaging	1.00
R7256:Plcl1	UTSW	1	55698218	missense	probably benign	0.45
R7522:Plcl1	UTSW	1	55696364	missense	probably benign	0.31
R7527:Plcl1	UTSW	1	55697114	missense	probably damaging	1.00
R7536:Plcl1	UTSW	1	55713481	nonsense	probably null
R7585:Plcl1	UTSW	1	55406449	missense	probably benign	0.00
R7591:Plcl1	UTSW	1	55697449	missense	probably benign	0.01
R7689:Plcl1	UTSW	1	55697468	missense	probably damaging	1.00
R7960:Plcl1	UTSW	1	55697284	missense	possibly damaging	0.48
R8029:Plcl1	UTSW	1	55696078	missense	probably benign	0.26
R8241:Plcl1	UTSW	1	55695817	missense	probably benign	0.01
R8323:Plcl1	UTSW	1	55697736	missense	possibly damaging	0.58
R9000:Plcl1	UTSW	1	55697831	missense	probably damaging	1.00
R9331:Plcl1	UTSW	1	55696871	missense	possibly damaging	0.95
R9358:Plcl1	UTSW	1	55696651	missense	probably damaging	1.00
R9432:Plcl1	UTSW	1	55406428	missense	probably benign
R9452:Plcl1	UTSW	1	55695833	missense	probably damaging	1.00
R9652:Plcl1	UTSW	1	55696291	missense	probably benign	0.00
R9802:Plcl1	UTSW	1	55696082	missense	probably damaging	0.98
Z1176:Plcl1	UTSW	1	55696040	missense	probably benign	0.20
Z1176:Plcl1	UTSW	1	55751284	nonsense	probably null
Z1177:Plcl1	UTSW	1	55696884	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- GTGACCCTTTTCGTTCACATAG -3'
(R):5'- TGGCCAAACTCAACCTTGTAC -3'

Sequencing Primer
(F):5'- TAGCAATAACCAATCGCAGTGG -3'
(R):5'- AACTCAACCTTGTACTCACAATTAG -3'

Posted On

2015-04-30