Mutagenetix > Incidental Mutation

Incidental Mutation 'R3975:Copa'

312567

Institutional Source

Beutler Lab

Gene Symbol

Copa

Ensembl Gene

ENSMUSG00000026553

Gene Name

coatomer protein complex subunit alpha

Synonyms

xenin

MMRRC Submission

040939-MU

Accession Numbers

Genbank: NM_009938; MGI: 1334462

Essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R3975 (G1)

Quality Score

216

Status

Not validated

Chromosome

Chromosomal Location

172082529-172122330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 172121245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1155 (S1155T)

Ref Sequence

ENSEMBL: ENSMUSP00000027833 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]

AlphaFold

Q8CIE6

Predicted Effect

probably benign
Transcript: ENSMUST00000027833
AA Change: S1155T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: S1155T

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	776	5.4e-144	PFAM
Pfam:COPI_C	824	1233	1.4e-190	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122845

Predicted Effect

probably benign
Transcript: ENSMUST00000135192
AA Change: S1146T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: S1146T

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	767	1.1e-148	PFAM
Pfam:COPI_C	815	1224	3.6e-216	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142765

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Copa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Copa	APN	1	172110688	missense	possibly damaging	0.87
IGL01360:Copa	APN	1	172087588	splice site	probably null
IGL01434:Copa	APN	1	172119561	missense	probably benign	0.00
IGL01744:Copa	APN	1	172113189	missense	probably benign	0.01
IGL01837:Copa	APN	1	172118852	missense	probably benign	0.01
IGL01988:Copa	APN	1	172118264	missense	probably benign	0.09
IGL02059:Copa	APN	1	172099753	missense	probably damaging	0.96
IGL02123:Copa	APN	1	172112128	missense	probably damaging	1.00
IGL02731:Copa	APN	1	172102218	missense	possibly damaging	0.77
IGL03114:Copa	APN	1	172119268	nonsense	probably null
P0027:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
PIT4434001:Copa	UTSW	1	172106175	missense	probably benign	0.00
R0233:Copa	UTSW	1	172087667	critical splice donor site	probably null
R0465:Copa	UTSW	1	172118305	missense	probably damaging	1.00
R0547:Copa	UTSW	1	172121687	splice site	probably benign
R0568:Copa	UTSW	1	172112137	missense	possibly damaging	0.91
R0628:Copa	UTSW	1	172091025	splice site	probably benign
R1328:Copa	UTSW	1	172121691	splice site	probably benign
R1494:Copa	UTSW	1	172104127	missense	probably benign	0.27
R1728:Copa	UTSW	1	172111987	missense	probably benign
R1758:Copa	UTSW	1	172104144	missense	probably damaging	1.00
R1784:Copa	UTSW	1	172111987	missense	probably benign
R1942:Copa	UTSW	1	172111888	missense	probably damaging	1.00
R2054:Copa	UTSW	1	172118957	nonsense	probably null
R2299:Copa	UTSW	1	172121725	missense	probably benign	0.10
R2518:Copa	UTSW	1	172119901	missense	probably benign
R2680:Copa	UTSW	1	172121404	nonsense	probably null
R3080:Copa	UTSW	1	172113149	missense	probably damaging	1.00
R3160:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3161:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3973:Copa	UTSW	1	172121245	missense	probably benign	0.00
R4031:Copa	UTSW	1	172108375	missense	probably damaging	1.00
R4155:Copa	UTSW	1	172101425	missense	probably damaging	1.00
R4227:Copa	UTSW	1	172118115	intron	probably benign
R4244:Copa	UTSW	1	172110718	missense	probably benign	0.00
R4254:Copa	UTSW	1	172102244	missense	probably damaging	1.00
R4291:Copa	UTSW	1	172092397	intron	probably benign
R4323:Copa	UTSW	1	172119264	missense	probably damaging	1.00
R4402:Copa	UTSW	1	172102224	missense	probably damaging	1.00
R4711:Copa	UTSW	1	172119988	missense	probably damaging	1.00
R4721:Copa	UTSW	1	172104274	splice site	probably benign
R4773:Copa	UTSW	1	172105220	missense	probably damaging	1.00
R4794:Copa	UTSW	1	172119321	missense	probably damaging	1.00
R4887:Copa	UTSW	1	172092276	missense	probably benign	0.39
R4953:Copa	UTSW	1	172082886	unclassified	probably benign
R5139:Copa	UTSW	1	172121329	missense	probably damaging	0.99
R5152:Copa	UTSW	1	172118061	missense	probably benign	0.34
R5297:Copa	UTSW	1	172113108	missense	probably damaging	1.00
R5586:Copa	UTSW	1	172105222	missense	probably damaging	1.00
R5698:Copa	UTSW	1	172118944	nonsense	probably null
R6283:Copa	UTSW	1	172118848	missense	possibly damaging	0.79
R6921:Copa	UTSW	1	172111924	missense	possibly damaging	0.63
R6934:Copa	UTSW	1	172110686	missense	possibly damaging	0.64
R7009:Copa	UTSW	1	172091000	missense	probably damaging	0.96
R7194:Copa	UTSW	1	172119944	missense	probably damaging	0.99
R7348:Copa	UTSW	1	172102223	missense	possibly damaging	0.96
R7710:Copa	UTSW	1	172109844	missense	possibly damaging	0.50
R7745:Copa	UTSW	1	172111942	missense	probably damaging	1.00
R7893:Copa	UTSW	1	172119565	nonsense	probably null
R8168:Copa	UTSW	1	172099672	missense	probably damaging	1.00
R8273:Copa	UTSW	1	172118979	critical splice donor site	probably null
R8704:Copa	UTSW	1	172104126	missense	probably benign	0.01
R8754:Copa	UTSW	1	172108359	missense	probably damaging	1.00
R8757:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8759:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8885:Copa	UTSW	1	172097745	missense	probably damaging	1.00
R8891:Copa	UTSW	1	172119251	missense	probably damaging	1.00
R8927:Copa	UTSW	1	172104170	missense	probably null	0.03
R8928:Copa	UTSW	1	172104170	missense	probably null	0.03
R8956:Copa	UTSW	1	172109913	missense	possibly damaging	0.65
R9063:Copa	UTSW	1	172116962	missense	probably benign	0.00
R9295:Copa	UTSW	1	172112256	missense	probably damaging	0.99
R9364:Copa	UTSW	1	172117264	missense	probably benign	0.00
R9437:Copa	UTSW	1	172104145	missense	possibly damaging	0.93
R9673:Copa	UTSW	1	172118081	missense	probably benign	0.11
T0722:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
Z1177:Copa	UTSW	1	172106123	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTGCGTTGTCATGTCCTG -3'
(R):5'- GCAGATTTGCCCCTTGAAC -3'

Sequencing Primer
(F):5'- CAGGCTGTCCTAGAACTTGAGATC -3'
(R):5'- AGATTTGCCCCTTGAACTCAGGG -3'

Posted On

2015-04-30