Mutagenetix > Incidental Mutations

Incidental Mutation 'R3975:Fbxo18'

312568

Institutional Source

Beutler Lab

Gene Symbol

Fbxo18

Ensembl Gene

ENSMUSG00000058594

Gene Name

F-box protein 18

Synonyms

Fbx18

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11742573-11777582 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 11767210 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 220 (H220R)

Ref Sequence

ENSEMBL: ENSMUSP00000071495 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071564]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071564
AA Change: H220R

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: H220R

Domain	Start	End	E-Value	Type
FBOX	213	256	3.94e-3	SMART
Pfam:UvrD-helicase	626	692	8e-10	PFAM
Pfam:UvrD_C	862	935	1.7e-12	PFAM
Pfam:UvrD_C_2	867	931	1.6e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126543

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151402

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192171

Meta Mutation Damage Score

0.1350

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Fbxo18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01615:Fbxo18	APN	2	11757523	nonsense	probably null
IGL02081:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02082:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02084:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02086:Fbxo18	APN	2	11764127	missense	probably benign	0.31
IGL02369:Fbxo18	APN	2	11747158	missense	possibly damaging	0.61
IGL02584:Fbxo18	APN	2	11759958	missense	probably benign	0.07
IGL03138:Fbxo18	UTSW	2	11749509	intron	probably benign
R0384:Fbxo18	UTSW	2	11749578	missense	probably damaging	1.00
R0479:Fbxo18	UTSW	2	11758419	missense	probably damaging	1.00
R0972:Fbxo18	UTSW	2	11764088	splice site	probably benign
R1420:Fbxo18	UTSW	2	11767682	missense	probably benign	0.01
R1827:Fbxo18	UTSW	2	11763888	missense	possibly damaging	0.88
R1832:Fbxo18	UTSW	2	11767400	missense	probably benign	0.08
R1960:Fbxo18	UTSW	2	11757528	missense	probably damaging	0.98
R2040:Fbxo18	UTSW	2	11769895	missense	possibly damaging	0.66
R2044:Fbxo18	UTSW	2	11762970	missense	possibly damaging	0.89
R2102:Fbxo18	UTSW	2	11758289	missense	probably benign	0.18
R3236:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R4504:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4505:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4507:Fbxo18	UTSW	2	11749017	missense	possibly damaging	0.91
R4799:Fbxo18	UTSW	2	11755747	missense	probably damaging	1.00
R4894:Fbxo18	UTSW	2	11762960	missense	probably damaging	1.00
R4994:Fbxo18	UTSW	2	11764230	missense	probably damaging	1.00
R5579:Fbxo18	UTSW	2	11748993	missense	probably damaging	0.97
R5801:Fbxo18	UTSW	2	11769826	missense	probably damaging	1.00
R6255:Fbxo18	UTSW	2	11748446	missense	probably benign	0.31
R7011:Fbxo18	UTSW	2	11762963	missense	probably damaging	1.00
R7177:Fbxo18	UTSW	2	11755711	missense	probably damaging	1.00
R7243:Fbxo18	UTSW	2	11751525	missense	probably benign	0.11
R7331:Fbxo18	UTSW	2	11763986	missense	probably benign
R7361:Fbxo18	UTSW	2	11747076	missense	probably damaging	1.00
R7460:Fbxo18	UTSW	2	11756685	missense	probably benign	0.38
R7541:Fbxo18	UTSW	2	11749537	missense	probably benign	0.05
R8000:Fbxo18	UTSW	2	11767289	missense	probably benign	0.21
R8010:Fbxo18	UTSW	2	11767632	missense	probably benign	0.15
R8056:Fbxo18	UTSW	2	11743630	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCATTCATGAGGCAAAGGGAAAC -3'
(R):5'- CATCGTGTTCAAGGCTTAGGG -3'

Sequencing Primer
(F):5'- GGAAACCACCACTTTGAAAAGGTC -3'
(R):5'- CTTAGGGAGGCCAGGCAAG -3'

Posted On

2015-04-30