Incidental Mutation 'R3975:Wipf1'
ID312570
Institutional Source Beutler Lab
Gene Symbol Wipf1
Ensembl Gene ENSMUSG00000075284
Gene NameWAS/WASL interacting protein family, member 1
SynonymsWIP, D2Ertd120e, Waspip
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location73429610-73529734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73437169 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 295 (G295D)
Ref Sequence ENSEMBL: ENSMUSP00000099741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094681] [ENSMUST00000102679] [ENSMUST00000102680] [ENSMUST00000141264]
Predicted Effect probably benign
Transcript: ENSMUST00000094681
AA Change: G295D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092268
Gene: ENSMUSG00000075284
AA Change: G295D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102679
AA Change: G295D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099740
Gene: ENSMUSG00000075284
AA Change: G295D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102680
AA Change: G295D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000099741
Gene: ENSMUSG00000075284
AA Change: G295D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
low complexity region 232 249 N/A INTRINSIC
low complexity region 274 317 N/A INTRINSIC
low complexity region 329 374 N/A INTRINSIC
low complexity region 398 424 N/A INTRINSIC
PDB:2IFS|A 441 470 1e-11 PDB
low complexity region 471 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141264
SMART Domains Protein: ENSMUSP00000119190
Gene: ENSMUSG00000075284

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
WH2 32 49 9.78e-4 SMART
low complexity region 64 108 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
low complexity region 185 196 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an important role in the organization of the actin cytoskeleton. The encoded protein binds to a region of Wiskott-Aldrich syndrome protein that is frequently mutated in Wiskott-Aldrich syndrome, an X-linked recessive disorder. Impairment of the interaction between these two proteins may contribute to the disease. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have immunological abnormalities, although lymphocyte development appears normal. Mutants show abnormal B and T cell proliferative responses, high serum immunoglobulin levels and impaired immunological synapse formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Wipf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Wipf1 APN 2 73447881 missense unknown
IGL02391:Wipf1 APN 2 73434143 missense probably damaging 1.00
IGL02992:Wipf1 APN 2 73434083 missense probably damaging 1.00
PIT1430001:Wipf1 UTSW 2 73437602 missense probably damaging 1.00
R1553:Wipf1 UTSW 2 73437526 missense possibly damaging 0.96
R1920:Wipf1 UTSW 2 73440155 missense probably benign 0.11
R3154:Wipf1 UTSW 2 73437490 missense possibly damaging 0.86
R3161:Wipf1 UTSW 2 73434949 missense probably damaging 0.99
R4996:Wipf1 UTSW 2 73440074 unclassified probably benign
R5218:Wipf1 UTSW 2 73444468 missense probably damaging 1.00
R6916:Wipf1 UTSW 2 73437404 missense probably damaging 1.00
R7006:Wipf1 UTSW 2 73437097 missense probably damaging 1.00
R7259:Wipf1 UTSW 2 73435081 missense probably damaging 0.99
R7486:Wipf1 UTSW 2 73440074 unclassified probably benign
R7689:Wipf1 UTSW 2 73432445 missense probably damaging 0.98
R7712:Wipf1 UTSW 2 73444461 missense probably damaging 1.00
R8094:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8095:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8120:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8136:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8150:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
R8152:Wipf1 UTSW 2 73437535 missense possibly damaging 0.67
Z1177:Wipf1 UTSW 2 73437364 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATACCTGATCTGCCTGGTGGATC -3'
(R):5'- AACCGAGGTGCTGCTTTTGG -3'

Sequencing Primer
(F):5'- CTGGTGGATCCCTTACAGGAG -3'
(R):5'- AGAACCCCTCCGGCTCCTC -3'
Posted On2015-04-30