Incidental Mutation 'R3975:Or8k40'
ID 312572
Institutional Source Beutler Lab
Gene Symbol Or8k40
Ensembl Gene ENSMUSG00000075172
Gene Name olfactory receptor family 8 subfamily K member 40
Synonyms MOR188-4, GA_x6K02T2Q125-48247345-48246404, Olfr1090
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R3975 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 86584139-86585080 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86584887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 65 (H65L)
Ref Sequence ENSEMBL: ENSMUSP00000149968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099875] [ENSMUST00000215991] [ENSMUST00000217043]
AlphaFold Q8VGA6
Predicted Effect probably damaging
Transcript: ENSMUST00000099875
AA Change: H65L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097460
Gene: ENSMUSG00000075172
AA Change: H65L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-47 PFAM
Pfam:7tm_1 41 290 7.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215991
AA Change: H65L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217043
AA Change: H65L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.1769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Orm3 A T 4: 63,274,395 (GRCm39) probably null Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Or8k40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Or8k40 APN 2 86,584,314 (GRCm39) missense probably benign 0.42
IGL01343:Or8k40 APN 2 86,584,843 (GRCm39) nonsense probably null
IGL01431:Or8k40 APN 2 86,584,508 (GRCm39) missense probably benign 0.12
IGL01771:Or8k40 APN 2 86,584,626 (GRCm39) missense probably benign 0.15
IGL03182:Or8k40 APN 2 86,584,366 (GRCm39) missense probably damaging 1.00
IGL03229:Or8k40 APN 2 86,584,360 (GRCm39) missense probably damaging 1.00
R0126:Or8k40 UTSW 2 86,584,981 (GRCm39) missense probably damaging 0.99
R0128:Or8k40 UTSW 2 86,584,231 (GRCm39) missense probably benign 0.39
R0130:Or8k40 UTSW 2 86,584,231 (GRCm39) missense probably benign 0.39
R1383:Or8k40 UTSW 2 86,584,838 (GRCm39) missense possibly damaging 0.80
R2100:Or8k40 UTSW 2 86,584,905 (GRCm39) missense possibly damaging 0.80
R2125:Or8k40 UTSW 2 86,584,796 (GRCm39) missense probably benign 0.00
R2126:Or8k40 UTSW 2 86,584,796 (GRCm39) missense probably benign 0.00
R2249:Or8k40 UTSW 2 86,584,398 (GRCm39) missense probably damaging 0.98
R3695:Or8k40 UTSW 2 86,584,215 (GRCm39) missense probably damaging 1.00
R3878:Or8k40 UTSW 2 86,584,972 (GRCm39) missense probably benign 0.02
R3940:Or8k40 UTSW 2 86,584,275 (GRCm39) missense possibly damaging 0.52
R3944:Or8k40 UTSW 2 86,584,525 (GRCm39) missense probably benign 0.17
R4387:Or8k40 UTSW 2 86,584,464 (GRCm39) missense probably benign 0.42
R4623:Or8k40 UTSW 2 86,584,906 (GRCm39) missense possibly damaging 0.80
R4740:Or8k40 UTSW 2 86,584,155 (GRCm39) missense probably benign 0.00
R6775:Or8k40 UTSW 2 86,584,921 (GRCm39) missense probably damaging 1.00
R7002:Or8k40 UTSW 2 86,585,025 (GRCm39) missense probably benign 0.01
R7746:Or8k40 UTSW 2 86,584,437 (GRCm39) missense probably damaging 1.00
R8296:Or8k40 UTSW 2 86,584,893 (GRCm39) missense probably damaging 0.99
R9038:Or8k40 UTSW 2 86,584,354 (GRCm39) missense probably damaging 1.00
R9243:Or8k40 UTSW 2 86,584,282 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TTTGGGACATGAGGACAGTG -3'
(R):5'- GAAGGAACACAATCTCACAGTAATG -3'

Sequencing Primer
(F):5'- TTACAGATGGCCACATAGCGGTC -3'
(R):5'- GACTGAATTCATCCTAATGGGTATC -3'
Posted On 2015-04-30