Incidental Mutation 'R3975:Olfr1090'
List |< first << previous [record 29 of 60] next >> last >|
ID312572
Institutional Source Beutler Lab
Gene Symbol Olfr1090
Ensembl Gene ENSMUSG00000075172
Gene Nameolfactory receptor 1090
SynonymsGA_x6K02T2Q125-48247345-48246404, MOR188-4
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86752724-86758993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86754543 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 65 (H65L)
Ref Sequence ENSEMBL: ENSMUSP00000149968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099875] [ENSMUST00000215991] [ENSMUST00000217043]
Predicted Effect probably damaging
Transcript: ENSMUST00000099875
AA Change: H65L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097460
Gene: ENSMUSG00000075172
AA Change: H65L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-47 PFAM
Pfam:7tm_1 41 290 7.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215991
AA Change: H65L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217043
AA Change: H65L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.1769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Olfr1090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Olfr1090 APN 2 86753970 missense probably benign 0.42
IGL01343:Olfr1090 APN 2 86754499 nonsense probably null
IGL01431:Olfr1090 APN 2 86754164 missense probably benign 0.12
IGL01771:Olfr1090 APN 2 86754282 missense probably benign 0.15
IGL03182:Olfr1090 APN 2 86754022 missense probably damaging 1.00
IGL03229:Olfr1090 APN 2 86754016 missense probably damaging 1.00
R0126:Olfr1090 UTSW 2 86754637 missense probably damaging 0.99
R0128:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R0130:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R1383:Olfr1090 UTSW 2 86754494 missense possibly damaging 0.80
R2100:Olfr1090 UTSW 2 86754561 missense possibly damaging 0.80
R2125:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2126:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2249:Olfr1090 UTSW 2 86754054 missense probably damaging 0.98
R3695:Olfr1090 UTSW 2 86753871 missense probably damaging 1.00
R3878:Olfr1090 UTSW 2 86754628 missense probably benign 0.02
R3940:Olfr1090 UTSW 2 86753931 missense possibly damaging 0.52
R3944:Olfr1090 UTSW 2 86754181 missense probably benign 0.17
R4387:Olfr1090 UTSW 2 86754120 missense probably benign 0.42
R4623:Olfr1090 UTSW 2 86754562 missense possibly damaging 0.80
R4740:Olfr1090 UTSW 2 86753811 missense probably benign 0.00
R6775:Olfr1090 UTSW 2 86754577 missense probably damaging 1.00
R7002:Olfr1090 UTSW 2 86754681 missense probably benign 0.01
R7746:Olfr1090 UTSW 2 86754093 missense probably damaging 1.00
R8296:Olfr1090 UTSW 2 86754549 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGGGACATGAGGACAGTG -3'
(R):5'- GAAGGAACACAATCTCACAGTAATG -3'

Sequencing Primer
(F):5'- TTACAGATGGCCACATAGCGGTC -3'
(R):5'- GACTGAATTCATCCTAATGGGTATC -3'
Posted On2015-04-30