Incidental Mutation 'R3975:Orm3'
ID 312584
Institutional Source Beutler Lab
Gene Symbol Orm3
Ensembl Gene ENSMUSG00000028359
Gene Name orosomucoid 3
Synonyms Orm-3, Agp-3
MMRRC Submission 040939-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R3975 (G1)
Quality Score 157
Status Validated
Chromosome 4
Chromosomal Location 63274399-63277748 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 63274395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006687]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000006687
SMART Domains Protein: ENSMUSP00000006687
Gene: ENSMUSG00000028359

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Lipocalin 40 180 4.8e-25 PFAM
low complexity region 185 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118337
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,586,888 (GRCm39) Y416* probably null Het
Akr1b10 G T 6: 34,369,431 (GRCm39) probably null Het
Arap2 G T 5: 62,906,237 (GRCm39) P261T possibly damaging Het
Bckdha C A 7: 25,330,858 (GRCm39) D53Y probably damaging Het
Bfsp2 A G 9: 103,357,271 (GRCm39) V52A probably benign Het
Bola3 T C 6: 83,328,249 (GRCm39) L45P probably benign Het
Cacna2d4 A G 6: 119,255,134 (GRCm39) probably null Het
Ccn6 C G 10: 39,031,094 (GRCm39) C143S probably damaging Het
Ceacam16 C A 7: 19,587,537 (GRCm39) Q410H probably damaging Het
Cenpe A G 3: 134,940,986 (GRCm39) probably null Het
Cenpe T C 3: 134,944,233 (GRCm39) probably null Het
Clca3a1 A T 3: 144,738,400 (GRCm39) V36D probably damaging Het
Copa T A 1: 171,948,812 (GRCm39) S1155T probably benign Het
Crb2 C A 2: 37,683,680 (GRCm39) P1061T possibly damaging Het
Crot T C 5: 9,027,541 (GRCm39) T264A probably benign Het
Cyp51 C T 5: 4,141,877 (GRCm39) G346S probably damaging Het
Dnah6 A G 6: 73,098,975 (GRCm39) S2027P possibly damaging Het
Fbh1 T C 2: 11,772,021 (GRCm39) H220R possibly damaging Het
Gdf2 T A 14: 33,666,791 (GRCm39) V171D probably damaging Het
Golgb1 T G 16: 36,738,933 (GRCm39) V2424G probably damaging Het
Gpbp1l1 T C 4: 116,428,182 (GRCm39) probably null Het
Gpx6 C A 13: 21,501,828 (GRCm39) S150Y probably damaging Het
Greb1l A G 18: 10,522,247 (GRCm39) N672S possibly damaging Het
Kcnma1 C T 14: 24,053,815 (GRCm39) probably null Het
Lrba T C 3: 86,258,562 (GRCm39) F1350L probably damaging Het
Nat8f4 A G 6: 85,878,052 (GRCm39) V157A possibly damaging Het
Niban1 T C 1: 151,525,086 (GRCm39) Y164H probably damaging Het
Nt5dc2 T C 14: 30,860,832 (GRCm39) S439P probably damaging Het
Or2ag12 T C 7: 106,276,992 (GRCm39) R234G probably damaging Het
Or2n1 A G 17: 38,486,386 (GRCm39) N137S probably benign Het
Or5t18 G A 2: 86,636,804 (GRCm39) P180S possibly damaging Het
Or8k40 T A 2: 86,584,887 (GRCm39) H65L probably damaging Het
Otof A G 5: 30,528,056 (GRCm39) L1929P probably damaging Het
Pex5l C A 3: 33,069,164 (GRCm39) C111F probably damaging Het
Plcl1 T A 1: 55,737,374 (GRCm39) M905K probably benign Het
Prdm6 T C 18: 53,673,278 (GRCm39) I186T possibly damaging Het
Rara T G 11: 98,861,395 (GRCm39) I236S probably damaging Het
Reln A T 5: 22,200,364 (GRCm39) S1379T possibly damaging Het
Rnps1-ps A T 6: 7,983,149 (GRCm39) noncoding transcript Het
Rp1l1 T A 14: 64,267,758 (GRCm39) Y1115N probably damaging Het
Rpe65 A T 3: 159,310,222 (GRCm39) N135I probably damaging Het
Rps6 A G 4: 86,775,050 (GRCm39) V18A probably benign Het
Scrn3 T C 2: 73,166,121 (GRCm39) S385P possibly damaging Het
Sis T C 3: 72,850,968 (GRCm39) T577A probably damaging Het
Slx1b G A 7: 126,290,979 (GRCm39) L239F probably damaging Het
Smad4 G T 18: 73,810,807 (GRCm39) T59K possibly damaging Het
Smad6 A G 9: 63,928,212 (GRCm39) V32A probably benign Het
Smc6 T A 12: 11,324,075 (GRCm39) F73L probably damaging Het
Sorbs2 T C 8: 46,225,747 (GRCm39) probably null Het
Svbp T A 4: 119,053,090 (GRCm39) F32I probably benign Het
Tap1 C A 17: 34,408,541 (GRCm39) probably benign Het
Tesk1 C T 4: 43,445,786 (GRCm39) P280S possibly damaging Het
Thrb A G 14: 18,033,456 (GRCm38) I406M probably damaging Het
Tsc22d1 T C 14: 76,656,049 (GRCm39) S761P probably damaging Het
Ttn T C 2: 76,706,997 (GRCm39) probably benign Het
Umodl1 C A 17: 31,203,763 (GRCm39) Y525* probably null Het
Vmn2r70 C T 7: 85,208,540 (GRCm39) V646I probably benign Het
Wipf1 C T 2: 73,267,513 (GRCm39) G295D probably benign Het
Zim1 A T 7: 6,680,129 (GRCm39) H511Q probably damaging Het
Other mutations in Orm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01972:Orm3 APN 4 63,277,563 (GRCm39) missense probably benign
P0033:Orm3 UTSW 4 63,274,539 (GRCm39) missense probably damaging 0.99
R0070:Orm3 UTSW 4 63,274,883 (GRCm39) missense probably benign 0.00
R0398:Orm3 UTSW 4 63,275,885 (GRCm39) missense probably benign
R1169:Orm3 UTSW 4 63,276,085 (GRCm39) missense probably damaging 0.97
R1551:Orm3 UTSW 4 63,275,146 (GRCm39) critical splice acceptor site probably null
R6767:Orm3 UTSW 4 63,274,531 (GRCm39) missense probably damaging 1.00
R6997:Orm3 UTSW 4 63,275,180 (GRCm39) missense probably damaging 1.00
R7128:Orm3 UTSW 4 63,276,062 (GRCm39) missense probably benign 0.25
R7708:Orm3 UTSW 4 63,276,050 (GRCm39) missense probably damaging 1.00
R8056:Orm3 UTSW 4 63,277,594 (GRCm39) missense probably benign
R8401:Orm3 UTSW 4 63,274,467 (GRCm39) missense possibly damaging 0.68
R9039:Orm3 UTSW 4 63,274,533 (GRCm39) missense possibly damaging 0.89
R9164:Orm3 UTSW 4 63,274,809 (GRCm39) missense probably damaging 1.00
R9333:Orm3 UTSW 4 63,274,528 (GRCm39) missense probably damaging 1.00
X0065:Orm3 UTSW 4 63,274,935 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCAGCCACTCTGGTGTAGG -3'
(R):5'- TCCTACAGTGAACAGGTCCAGG -3'

Sequencing Primer
(F):5'- AGGAGCCTGTGTCACAGC -3'
(R):5'- AACAGGTCCAGGCCCCG -3'
Posted On 2015-04-30