Incidental Mutation 'R3975:Rps6'
ID312585
Institutional Source Beutler Lab
Gene Symbol Rps6
Ensembl Gene ENSMUSG00000028495
Gene Nameribosomal protein S6
SynonymsS6R
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R3975 (G1)
Quality Score224
Status Validated
Chromosome4
Chromosomal Location86854660-86857412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86856813 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 18 (V18A)
Ref Sequence ENSEMBL: ENSMUSP00000099878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102814]
Predicted Effect probably benign
Transcript: ENSMUST00000102814
AA Change: V18A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099878
Gene: ENSMUSG00000028495
AA Change: V18A

DomainStartEndE-ValueType
Pfam:Ribosomal_S6e 1 126 2.3e-72 PFAM
coiled coil region 194 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136174
Meta Mutation Damage Score 0.4325 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 40S subunit. The protein belongs to the S6E family of ribosomal proteins. It is the major substrate of protein kinases in the ribosome, with subsets of five C-terminal serine residues phosphorylated by different protein kinases. Phosphorylation is induced by a wide range of stimuli, including growth factors, tumor-promoting agents, and mitogens. Dephosphorylation occurs at growth arrest. The protein may contribute to the control of cell growth and proliferation through the selective translation of particular classes of mRNA. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with an inducible, liver-specific null mutation exhibit failure of liver regeneration and an absence of 40S ribosomes in hepatocytes. Mice with a mutation where serines are unphosphorylatable exhibit hypoinsulinemia, impaired glucose tolerance, and smaller MEFs and beta cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Crot T C 5: 8,977,541 T264A probably benign Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Rps6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0346:Rps6 UTSW 4 86855981 missense probably benign 0.02
R1691:Rps6 UTSW 4 86856809 missense probably benign
R8077:Rps6 UTSW 4 86855921 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTGAATTCCGTACGGCAAG -3'
(R):5'- CAGAGCTCCTGTAAAATGTCCCG -3'

Sequencing Primer
(F):5'- AAGAAGCATGTCCTTTCGGC -3'
(R):5'- CCTGTAAAATGTCCCGTGGATGC -3'
Posted On2015-04-30