Mutagenetix > Incidental Mutations

Incidental Mutation 'R3975:Cyp51'

312588

Institutional Source

Beutler Lab

Gene Symbol

Cyp51

Ensembl Gene

ENSMUSG00000001467

Gene Name

cytochrome P450, family 51

Synonyms

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4081145-4104746 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4091877 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 346 (G346S)

Ref Sequence

ENSEMBL: ENSMUSP00000001507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001507]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001507
AA Change: G346S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000001507
Gene: ENSMUSG00000001467
AA Change: G346S

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:p450	61	496	1.9e-76	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129448

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal and craniofacial abnormalities and die at late midgestation due to heart failure resulting from cardiac hypoplasia, ventricle septum, epicardial and vasculogenesis defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Cyp51

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02045:Cyp51	APN	5	4083247	missense	probably damaging	1.00
IGL02047:Cyp51	APN	5	4099244	missense	possibly damaging	0.86
IGL02191:Cyp51	APN	5	4100147	missense	probably benign	0.05
IGL02492:Cyp51	APN	5	4104304	missense	probably benign	0.01
IGL03209:Cyp51	APN	5	4104195	missense	probably damaging	1.00
PIT4515001:Cyp51	UTSW	5	4099122	critical splice donor site	probably null
PIT4520001:Cyp51	UTSW	5	4101200	missense	probably damaging	1.00
R0535:Cyp51	UTSW	5	4099202	missense	probably benign	0.00
R2048:Cyp51	UTSW	5	4086636	splice site	probably benign
R2165:Cyp51	UTSW	5	4086594	missense	probably damaging	1.00
R2851:Cyp51	UTSW	5	4099183	missense	probably damaging	1.00
R4799:Cyp51	UTSW	5	4083256	missense	probably damaging	1.00
R5699:Cyp51	UTSW	5	4101213	missense	probably damaging	1.00
R6163:Cyp51	UTSW	5	4100199	missense	probably damaging	1.00
R6484:Cyp51	UTSW	5	4086627	missense	probably benign	0.07
R7046:Cyp51	UTSW	5	4100188	missense	probably damaging	1.00
R7155:Cyp51	UTSW	5	4087846	missense	possibly damaging	0.90
R7877:Cyp51	UTSW	5	4102929	missense	probably damaging	1.00
R7904:Cyp51	UTSW	5	4100173	missense	probably damaging	0.99
R7960:Cyp51	UTSW	5	4102929	missense	probably damaging	1.00
R7987:Cyp51	UTSW	5	4100173	missense	probably damaging	0.99
R8094:Cyp51	UTSW	5	4086490	missense	probably benign	0.08
R8095:Cyp51	UTSW	5	4086490	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TCGAGCTGTGAGAACCACTG -3'
(R):5'- TCTGCCCAGATGTTAAGTGTG -3'

Sequencing Primer
(F):5'- GAACCACTGTTCTGTACTCAGTAC -3'
(R):5'- GTGGTTCATCTCCAGGGAC -3'

Posted On

2015-04-30