Mutagenetix > Incidental Mutations

Incidental Mutation 'R3975:Crot'

312589

Institutional Source

Beutler Lab

Gene Symbol

Crot

Ensembl Gene

ENSMUSG00000003623

Gene Name

carnitine O-octanoyltransferase

Synonyms

1200003H03Rik

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.115) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8966033-8997324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8977541 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 264 (T264A)

Ref Sequence

ENSEMBL: ENSMUSP00000003720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003720]

PDB Structure

Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000003720
AA Change: T264A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: T264A

Domain	Start	End	E-Value	Type
Pfam:Carn_acyltransf	20	604	2.3e-167	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146115

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Crot

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00756:Crot	APN	5	8976072	missense	probably damaging	1.00
IGL01013:Crot	APN	5	8993575	missense	probably benign	0.06
IGL01085:Crot	APN	5	8973955	missense	probably damaging	1.00
IGL02017:Crot	APN	5	8970046	splice site	probably benign
IGL02306:Crot	APN	5	8968701	missense	possibly damaging	0.94
IGL02612:Crot	APN	5	8969945	missense	probably damaging	1.00
IGL02884:Crot	APN	5	8978197	critical splice donor site	probably null
IGL03091:Crot	APN	5	8966897	missense	probably benign
IGL03356:Crot	APN	5	8988295	splice site	probably benign
ouray	UTSW	5	8993504	critical splice donor site	probably null
R0383:Crot	UTSW	5	8968734	missense	probably damaging	1.00
R0396:Crot	UTSW	5	8969959	missense	probably damaging	1.00
R0502:Crot	UTSW	5	8976075	missense	possibly damaging	0.66
R0503:Crot	UTSW	5	8976075	missense	possibly damaging	0.66
R0676:Crot	UTSW	5	8993622	utr 5 prime	probably benign
R1079:Crot	UTSW	5	8993504	critical splice donor site	probably null
R1472:Crot	UTSW	5	8966941	missense	probably damaging	1.00
R1595:Crot	UTSW	5	8974186	missense	probably benign	0.00
R1757:Crot	UTSW	5	8987828	missense	probably damaging	1.00
R1828:Crot	UTSW	5	8969080	missense	probably benign	0.01
R1846:Crot	UTSW	5	8988248	missense	probably benign	0.36
R2142:Crot	UTSW	5	8987780	missense	possibly damaging	0.94
R3973:Crot	UTSW	5	8977541	missense	probably benign
R3974:Crot	UTSW	5	8977541	missense	probably benign
R4445:Crot	UTSW	5	8973643	missense	probably damaging	1.00
R4446:Crot	UTSW	5	8973643	missense	probably damaging	1.00
R4995:Crot	UTSW	5	8974000	missense	probably damaging	1.00
R5084:Crot	UTSW	5	8969994	missense	probably damaging	1.00
R5464:Crot	UTSW	5	8983690	splice site	probably null
R5673:Crot	UTSW	5	8988131	missense	probably benign	0.00
R5814:Crot	UTSW	5	8973996	missense	probably damaging	0.99
R5935:Crot	UTSW	5	8974192	missense	probably benign
R5951:Crot	UTSW	5	8969120	nonsense	probably null
R6862:Crot	UTSW	5	8989641	missense	probably damaging	0.99
R6885:Crot	UTSW	5	8973635	missense	probably benign	0.00
R6983:Crot	UTSW	5	8978280	missense	probably benign	0.06
R7150:Crot	UTSW	5	8987878	missense	probably damaging	0.99
R7228:Crot	UTSW	5	8976051	missense	probably damaging	1.00
R7361:Crot	UTSW	5	8977534	missense	probably damaging	1.00
R7662:Crot	UTSW	5	8969072	missense	probably damaging	1.00
R7747:Crot	UTSW	5	8968869	critical splice donor site	probably null
R8002:Crot	UTSW	5	8993599	missense	probably benign	0.36
R8105:Crot	UTSW	5	8977505	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCTACACAATATAGTTCATAGGTG -3'
(R):5'- GGGCAAAGGTAATAATCCATGCT -3'

Sequencing Primer
(F):5'- TAGGTGAGAAAAATTCTAAGACCCTG -3'
(R):5'- TCCCAGAAGCTGTCGTGTGAATAG -3'

Posted On

2015-04-30