Incidental Mutation 'R3975:Crot'
List |< first << previous [record 14 of 60] next >> last >|
ID312589
Institutional Source Beutler Lab
Gene Symbol Crot
Ensembl Gene ENSMUSG00000003623
Gene Namecarnitine O-octanoyltransferase
Synonyms1200003H03Rik
MMRRC Submission 040939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R3975 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location8966033-8997324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8977541 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 264 (T264A)
Ref Sequence ENSEMBL: ENSMUSP00000003720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003720]
PDB Structure
Crystal Structure of Mouse Carnitine Octanoyltransferase [X-RAY DIFFRACTION]
Crystal structure of mouse carnitine octanoyltransferase in complex with octanoylcarnitine [X-RAY DIFFRACTION]
C323M mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
M335V mutant structure of mouse carnitine octanoyltransferase [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003720
AA Change: T264A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003720
Gene: ENSMUSG00000003623
AA Change: T264A

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 20 604 2.3e-167 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146115
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carnitine/choline acetyltransferase family. The encoded protein converts 4,8-dimethylnonanoyl-CoA to its corresponding carnitine ester. This transesterification occurs in the peroxisome and is necessary for transport of medium- and long- chain acyl-CoA molecules out of the peroxisome to the cytosol and mitochondria. The protein thus plays a role in lipid metabolism and fatty acid beta-oxidation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam23 T A 1: 63,547,729 Y416* probably null Het
Akr1b10 G T 6: 34,392,496 probably null Het
Arap2 G T 5: 62,748,894 P261T possibly damaging Het
Bckdha C A 7: 25,631,433 D53Y probably damaging Het
Bfsp2 A G 9: 103,480,072 V52A probably benign Het
Bola3 T C 6: 83,351,267 L45P probably benign Het
Cacna2d4 A G 6: 119,278,173 probably null Het
Ceacam16 C A 7: 19,853,612 Q410H probably damaging Het
Cenpe A G 3: 135,235,225 probably null Het
Cenpe T C 3: 135,238,472 probably null Het
Clca1 A T 3: 145,032,639 V36D probably damaging Het
Copa T A 1: 172,121,245 S1155T probably benign Het
Crb2 C A 2: 37,793,668 P1061T possibly damaging Het
Cyp51 C T 5: 4,091,877 G346S probably damaging Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Fam129a T C 1: 151,649,335 Y164H probably damaging Het
Fbxo18 T C 2: 11,767,210 H220R possibly damaging Het
Gdf2 T A 14: 33,944,834 V171D probably damaging Het
Gm9825 A T 6: 7,983,149 noncoding transcript Het
Golgb1 T G 16: 36,918,571 V2424G probably damaging Het
Gpbp1l1 T C 4: 116,570,985 probably null Het
Gpx6 C A 13: 21,317,658 S150Y probably damaging Het
Greb1l A G 18: 10,522,247 N672S possibly damaging Het
Kcnma1 C T 14: 24,003,747 probably null Het
Lrba T C 3: 86,351,255 F1350L probably damaging Het
Nat8f4 A G 6: 85,901,070 V157A possibly damaging Het
Nt5dc2 T C 14: 31,138,875 S439P probably damaging Het
Olfr1090 T A 2: 86,754,543 H65L probably damaging Het
Olfr134 A G 17: 38,175,495 N137S probably benign Het
Olfr141 G A 2: 86,806,460 P180S possibly damaging Het
Olfr693 T C 7: 106,677,785 R234G probably damaging Het
Orm3 A T 4: 63,356,158 probably null Het
Otof A G 5: 30,370,712 L1929P probably damaging Het
Pex5l C A 3: 33,015,015 C111F probably damaging Het
Plcl1 T A 1: 55,698,215 M905K probably benign Het
Prdm6 T C 18: 53,540,206 I186T possibly damaging Het
Rara T G 11: 98,970,569 I236S probably damaging Het
Reln A T 5: 21,995,366 S1379T possibly damaging Het
Rp1l1 T A 14: 64,030,309 Y1115N probably damaging Het
Rpe65 A T 3: 159,604,585 N135I probably damaging Het
Rps6 A G 4: 86,856,813 V18A probably benign Het
Scrn3 T C 2: 73,335,777 S385P possibly damaging Het
Sis T C 3: 72,943,635 T577A probably damaging Het
Slx1b G A 7: 126,691,807 L239F probably damaging Het
Smad4 G T 18: 73,677,736 T59K possibly damaging Het
Smad6 A G 9: 64,020,930 V32A probably benign Het
Smc6 T A 12: 11,274,074 F73L probably damaging Het
Sorbs2 T C 8: 45,772,710 probably null Het
Svbp T A 4: 119,195,893 F32I probably benign Het
Tap1 C A 17: 34,189,567 probably benign Het
Tesk1 C T 4: 43,445,786 P280S possibly damaging Het
Thrb A G 14: 18,033,456 I406M probably damaging Het
Tsc22d1 T C 14: 76,418,609 S761P probably damaging Het
Ttn T C 2: 76,876,653 probably benign Het
Umodl1 C A 17: 30,984,789 Y525* probably null Het
Vmn2r70 C T 7: 85,559,332 V646I probably benign Het
Wipf1 C T 2: 73,437,169 G295D probably benign Het
Wisp3 C G 10: 39,155,098 C143S probably damaging Het
Zim1 A T 7: 6,677,130 H511Q probably damaging Het
Other mutations in Crot
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Crot APN 5 8976072 missense probably damaging 1.00
IGL01013:Crot APN 5 8993575 missense probably benign 0.06
IGL01085:Crot APN 5 8973955 missense probably damaging 1.00
IGL02017:Crot APN 5 8970046 splice site probably benign
IGL02306:Crot APN 5 8968701 missense possibly damaging 0.94
IGL02612:Crot APN 5 8969945 missense probably damaging 1.00
IGL02884:Crot APN 5 8978197 critical splice donor site probably null
IGL03091:Crot APN 5 8966897 missense probably benign
IGL03356:Crot APN 5 8988295 splice site probably benign
ouray UTSW 5 8993504 critical splice donor site probably null
R0383:Crot UTSW 5 8968734 missense probably damaging 1.00
R0396:Crot UTSW 5 8969959 missense probably damaging 1.00
R0502:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0503:Crot UTSW 5 8976075 missense possibly damaging 0.66
R0676:Crot UTSW 5 8993622 utr 5 prime probably benign
R1079:Crot UTSW 5 8993504 critical splice donor site probably null
R1472:Crot UTSW 5 8966941 missense probably damaging 1.00
R1595:Crot UTSW 5 8974186 missense probably benign 0.00
R1757:Crot UTSW 5 8987828 missense probably damaging 1.00
R1828:Crot UTSW 5 8969080 missense probably benign 0.01
R1846:Crot UTSW 5 8988248 missense probably benign 0.36
R2142:Crot UTSW 5 8987780 missense possibly damaging 0.94
R3973:Crot UTSW 5 8977541 missense probably benign
R3974:Crot UTSW 5 8977541 missense probably benign
R4445:Crot UTSW 5 8973643 missense probably damaging 1.00
R4446:Crot UTSW 5 8973643 missense probably damaging 1.00
R4995:Crot UTSW 5 8974000 missense probably damaging 1.00
R5084:Crot UTSW 5 8969994 missense probably damaging 1.00
R5464:Crot UTSW 5 8983690 splice site probably null
R5673:Crot UTSW 5 8988131 missense probably benign 0.00
R5814:Crot UTSW 5 8973996 missense probably damaging 0.99
R5935:Crot UTSW 5 8974192 missense probably benign
R5951:Crot UTSW 5 8969120 nonsense probably null
R6862:Crot UTSW 5 8989641 missense probably damaging 0.99
R6885:Crot UTSW 5 8973635 missense probably benign 0.00
R6983:Crot UTSW 5 8978280 missense probably benign 0.06
R7150:Crot UTSW 5 8987878 missense probably damaging 0.99
R7228:Crot UTSW 5 8976051 missense probably damaging 1.00
R7361:Crot UTSW 5 8977534 missense probably damaging 1.00
R7662:Crot UTSW 5 8969072 missense probably damaging 1.00
R7747:Crot UTSW 5 8968869 critical splice donor site probably null
R8002:Crot UTSW 5 8993599 missense probably benign 0.36
R8105:Crot UTSW 5 8977505 missense probably damaging 0.99
R8233:Crot UTSW 5 8976027 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCCCTACACAATATAGTTCATAGGTG -3'
(R):5'- GGGCAAAGGTAATAATCCATGCT -3'

Sequencing Primer
(F):5'- TAGGTGAGAAAAATTCTAAGACCCTG -3'
(R):5'- TCCCAGAAGCTGTCGTGTGAATAG -3'
Posted On2015-04-30