Mutagenetix > Incidental Mutation

Incidental Mutation 'R3975:Otof'

312591

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.192) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30370712 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1929 (L1929P)

Ref Sequence

ENSEMBL: ENSMUSP00000110395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000101448] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074171
AA Change: L1934P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: L1934P

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000101448

SMART Domains

Protein: ENSMUSP00000098992
Gene: ENSMUSG00000073102

Domain	Start	End	E-Value	Type
low complexity region	33	55	N/A	INTRINSIC
low complexity region	62	79	N/A	INTRINSIC
Pfam:NYD-SP28	100	200	1.7e-33	PFAM
coiled coil region	280	318	N/A	INTRINSIC
low complexity region	455	473	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
low complexity region	599	612	N/A	INTRINSIC
Pfam:NYD-SP28_assoc	673	732	2.2e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114747
AA Change: L1929P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: L1929P

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200001

Meta Mutation Damage Score

0.5252

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Bola3	T	C	6: 83,351,267	L45P	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0285:Otof	UTSW	5	30379533	critical splice donor site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTTTCTTTGAAGATGAGC -3'
(R):5'- ACCACTTCCTGCTTGGGATC -3'

Sequencing Primer
(F):5'- TTCAGAGGGAAGAGGTAGCTTC -3'
(R):5'- TCCTGCTTGGGATCCGACC -3'

Posted On

2015-04-30