Mutagenetix > Incidental Mutations

Incidental Mutation 'R3975:Bola3'

312596

Institutional Source

Beutler Lab

Gene Symbol

Bola3

Ensembl Gene

ENSMUSG00000045160

Gene Name

bolA-like 3 (E. coli)

Synonyms

MMRRC Submission

040939-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R3975 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83349147-83360136 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 83351267 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 45 (L45P)

Ref Sequence

ENSEMBL: ENSMUSP00000112582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120040] [ENSMUST00000122216] [ENSMUST00000136501]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000055875

Predicted Effect

probably benign
Transcript: ENSMUST00000120040
AA Change: L45P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000112582
Gene: ENSMUSG00000045160
AA Change: L45P

Domain	Start	End	E-Value	Type
Pfam:BolA	60	135	4.6e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122216
AA Change: L4P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113439
Gene: ENSMUSG00000045160
AA Change: L4P

Domain	Start	End	E-Value	Type
Pfam:BolA	26	94	7.5e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133122

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134765

Predicted Effect

probably benign
Transcript: ENSMUST00000136501
AA Change: L19P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118348
Gene: ENSMUSG00000045160
AA Change: L19P

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
Pfam:BolA	41	109	4e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148875

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151329

Meta Mutation Damage Score

0.1588

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays an essential role in the production of iron-sulfur (Fe-S) clusters for the normal maturation of lipoate-containing 2-oxoacid dehydrogenases, and for the assembly of the mitochondrial respiratory chain complexes. Mutation in this gene has been associated with multiple mitochondrial dysfunctions syndrome-2. Two alternatively spliced transcript variants encoding different isoforms with distinct subcellular localization have been reported for this gene (PMID:21944046). [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam23	T	A	1: 63,547,729	Y416*	probably null	Het
Akr1b10	G	T	6: 34,392,496		probably null	Het
Arap2	G	T	5: 62,748,894	P261T	possibly damaging	Het
Bckdha	C	A	7: 25,631,433	D53Y	probably damaging	Het
Bfsp2	A	G	9: 103,480,072	V52A	probably benign	Het
Cacna2d4	A	G	6: 119,278,173		probably null	Het
Ceacam16	C	A	7: 19,853,612	Q410H	probably damaging	Het
Cenpe	A	G	3: 135,235,225		probably null	Het
Cenpe	T	C	3: 135,238,472		probably null	Het
Clca1	A	T	3: 145,032,639	V36D	probably damaging	Het
Copa	T	A	1: 172,121,245	S1155T	probably benign	Het
Crb2	C	A	2: 37,793,668	P1061T	possibly damaging	Het
Crot	T	C	5: 8,977,541	T264A	probably benign	Het
Cyp51	C	T	5: 4,091,877	G346S	probably damaging	Het
Dnah6	A	G	6: 73,121,992	S2027P	possibly damaging	Het
Fam129a	T	C	1: 151,649,335	Y164H	probably damaging	Het
Fbxo18	T	C	2: 11,767,210	H220R	possibly damaging	Het
Gdf2	T	A	14: 33,944,834	V171D	probably damaging	Het
Gm9825	A	T	6: 7,983,149		noncoding transcript	Het
Golgb1	T	G	16: 36,918,571	V2424G	probably damaging	Het
Gpbp1l1	T	C	4: 116,570,985		probably null	Het
Gpx6	C	A	13: 21,317,658	S150Y	probably damaging	Het
Greb1l	A	G	18: 10,522,247	N672S	possibly damaging	Het
Kcnma1	C	T	14: 24,003,747		probably null	Het
Lrba	T	C	3: 86,351,255	F1350L	probably damaging	Het
Nat8f4	A	G	6: 85,901,070	V157A	possibly damaging	Het
Nt5dc2	T	C	14: 31,138,875	S439P	probably damaging	Het
Olfr1090	T	A	2: 86,754,543	H65L	probably damaging	Het
Olfr134	A	G	17: 38,175,495	N137S	probably benign	Het
Olfr141	G	A	2: 86,806,460	P180S	possibly damaging	Het
Olfr693	T	C	7: 106,677,785	R234G	probably damaging	Het
Orm3	A	T	4: 63,356,158		probably null	Het
Otof	A	G	5: 30,370,712	L1929P	probably damaging	Het
Pex5l	C	A	3: 33,015,015	C111F	probably damaging	Het
Plcl1	T	A	1: 55,698,215	M905K	probably benign	Het
Prdm6	T	C	18: 53,540,206	I186T	possibly damaging	Het
Rara	T	G	11: 98,970,569	I236S	probably damaging	Het
Reln	A	T	5: 21,995,366	S1379T	possibly damaging	Het
Rp1l1	T	A	14: 64,030,309	Y1115N	probably damaging	Het
Rpe65	A	T	3: 159,604,585	N135I	probably damaging	Het
Rps6	A	G	4: 86,856,813	V18A	probably benign	Het
Scrn3	T	C	2: 73,335,777	S385P	possibly damaging	Het
Sis	T	C	3: 72,943,635	T577A	probably damaging	Het
Slx1b	G	A	7: 126,691,807	L239F	probably damaging	Het
Smad4	G	T	18: 73,677,736	T59K	possibly damaging	Het
Smad6	A	G	9: 64,020,930	V32A	probably benign	Het
Smc6	T	A	12: 11,274,074	F73L	probably damaging	Het
Sorbs2	T	C	8: 45,772,710		probably null	Het
Svbp	T	A	4: 119,195,893	F32I	probably benign	Het
Tap1	C	A	17: 34,189,567		probably benign	Het
Tesk1	C	T	4: 43,445,786	P280S	possibly damaging	Het
Thrb	A	G	14: 18,033,456	I406M	probably damaging	Het
Tsc22d1	T	C	14: 76,418,609	S761P	probably damaging	Het
Ttn	T	C	2: 76,876,653		probably benign	Het
Umodl1	C	A	17: 30,984,789	Y525*	probably null	Het
Vmn2r70	C	T	7: 85,559,332	V646I	probably benign	Het
Wipf1	C	T	2: 73,437,169	G295D	probably benign	Het
Wisp3	C	G	10: 39,155,098	C143S	probably damaging	Het
Zim1	A	T	7: 6,677,130	H511Q	probably damaging	Het

Other mutations in Bola3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R2967:Bola3	UTSW	6	83349298	missense	probably benign	0.00
R3976:Bola3	UTSW	6	83351267	missense	probably benign	0.03
R5425:Bola3	UTSW	6	83349552	missense	probably benign
R8845:Bola3	UTSW	6	83358172	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAAGTCTAGGTAGTGAGCGCC -3'
(R):5'- TCATTGGGTCAAGTGCCCTC -3'

Sequencing Primer
(F):5'- CCTGCTCTGGCCCTTCAGG -3'
(R):5'- GGTCAAGTGCCCTCCTCATG -3'

Posted On

2015-04-30